Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: U79666.1
Subject Sequence ID: ENSG00000141837
Subject Sequence type: 2


seq1 = /RAID/mart2/Splice/web_temp/fasta/U79666.1, 7827 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000141837 (ENSG00000141837), 298924 bp

>gi|2281751|gb|U79666.1|HSU79666 Homo sapiens alpha1A-voltage-dependent calcium channel mRNA, splice form BI-1-Vi-GGCAG, complete cds
>ENSG00000141837

(complement)

218-510  (1-293)   100% ->
511-616  (51013-51118)   100% ->
617-756  (53210-53349)   100% ->
757-848  (134446-134537)   100% ->
849-1001  (140756-140908)   100% ->
1002-1195  (146426-146619)   100% ->
1196-1299  (170316-170419)   100% ->
1300-1415  (171732-171847)   99% ->
1416-1472  (173300-173356)   100% ->
1473-1565  (175889-175981)   100% ->
1566-1775  (188904-189113)   100% ->
1776-1888  (193444-193556)   100% ->
1889-2001  (197697-197809)   100% ->
2002-2133  (197974-198105)   100% ->
2134-2206  (198371-198443)   100% ->
2207-2324  (202341-202458)   100% ->
2325-2392  (202612-202679)   100% ->
2393-2499  (205569-205675)   100% ->
2500-3309  (206872-207681)   100% ->
3310-3773  (219259-219722)   100% ->
3774-3912  (221019-221157)   100% ->
3913-4042  (222829-222958)   100% ->
4043-4102  (229097-229156)   100% ->
4103-4209  (230269-230375)   100% ->
4210-4309  (243392-243491)   100% ->
4310-4470  (244615-244775)   100% ->
4471-4608  (246524-246661)   100% ->
4609-4810  (248674-248875)   100% ->
4811-4975  (250966-251130)   100% ->
4976-5086  (253124-253234)   100% ->
5087-5170  (260960-261043)   100% ->
5171-5287  (270495-270611)   100% ->
5288-5353  (270951-271016)   100% ->
5354-5469  (271189-271304)   100% ->
5470-5620  (274365-274515)   100% ->
5621-5748  (276016-276143)   100% ->
5749-5845  (277430-277526)   100% ->
5846-5951  (281453-281558)   100% ->
5952-6059  (291617-291724)   100% ->
6060-6160  (291892-291992)   100% ->
6161-6270  (293485-293594)   100% ->
6271-6409  (293703-293841)   100% ->
6410-6523  (294009-294122)   100% ->
6524-6559  (295573-295608)   100% ->
6560-6746  (296727-296913)   100% ->
6747-7000  (297216-297469)   100% ->
7001-7747  (298172-298924)   99%

      0     .    :    .    :    .    :    .    :    .    :
    218 ATGGCCCGCTTCGGAGACGAGATGCCGGCCCGCTACGGGGGAGGAGGCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      1 ATGGCCCGCTTCGGAGACGAGATGCCGGCCCGCTACGGGGGAGGAGGCTC

     50     .    :    .    :    .    :    .    :    .    :
    268 CGGGGCAGCCGCCGGGGTGGTCGTGGGCAGCGGAGGCGGGCGAGGAGCCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     51 CGGGGCAGCCGCCGGGGTGGTCGTGGGCAGCGGAGGCGGGCGAGGAGCCG

    100     .    :    .    :    .    :    .    :    .    :
    318 GGGGCAGCCGGCAGGGCGGGCAGCCCGGGGCGCAAAGGATGTACAAGCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    101 GGGGCAGCCGGCAGGGCGGGCAGCCCGGGGCGCAAAGGATGTACAAGCAG

    150     .    :    .    :    .    :    .    :    .    :
    368 TCAATGGCGCAGAGAGCGCGGACCATGGCACTCTACAACCCCATCCCCGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    151 TCAATGGCGCAGAGAGCGCGGACCATGGCACTCTACAACCCCATCCCCGT

    200     .    :    .    :    .    :    .    :    .    :
    418 CCGACAGAACTGCCTCACGGTTAACCGGTCTCTCTTCCTCTTCAGCGAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    201 CCGACAGAACTGCCTCACGGTTAACCGGTCTCTCTTCCTCTTCAGCGAAG

    250     .    :    .    :    .    :    .    :    .    :
    468 ACAACGTGGTGAGAAAATACGCCAAAAAGATCACCGAATGGCC       
        |||||||||||||||||||||||||||||||||||||||||||>>>...>
    251 ACAACGTGGTGAGAAAATACGCCAAAAAGATCACCGAATGGCCATA...T

    300     .    :    .    :    .    :    .    :    .    :
    511   TCCCTTTGAATATATGATTTTAGCCACCATCATAGCGAATTGCATCGT
        >>||||||||||||||||||||||||||||||||||||||||||||||||
  51011 ACTCCCTTTGAATATATGATTTTAGCCACCATCATAGCGAATTGCATCGT

    350     .    :    .    :    .    :    .    :    .    :
    559 CCTCGCACTGGAGCAGCATCTGCCTGATGATGACAAGACCCCGATGTCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  51061 CCTCGCACTGGAGCAGCATCTGCCTGATGATGACAAGACCCCGATGTCTG

    400     .    :    .    :    .    :    .    :    .    :
    609 AACGGCTG         GATGACACAGAACCATACTTCATTGGAATTTTT
        ||||||||>>>...>>>|||||||||||||||||||||||||||||||||
  51111 AACGGCTGGTG...CAGGATGACACAGAACCATACTTCATTGGAATTTTT

    450     .    :    .    :    .    :    .    :    .    :
    650 TGTTTCGAGGCTGGAATTAAAATCATTGCCCTTGGGTTTGCCTTCCACAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  53243 TGTTTCGAGGCTGGAATTAAAATCATTGCCCTTGGGTTTGCCTTCCACAA

    500     .    :    .    :    .    :    .    :    .    :
    700 AGGCTCCTACTTGAGGAATGGCTGGAATGTCATGGACTTTGTGGTGGTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  53293 AGGCTCCTACTTGAGGAATGGCTGGAATGTCATGGACTTTGTGGTGGTGC

    550     .    :    .    :    .    :    .    :    .    :
    750 TAACGGG         CATCTTGGCGACAGTTGGGACGGAGTTTGACCTA
        |||||||>>>...>>>||||||||||||||||||||||||||||||||||
  53343 TAACGGGGTA...CAGCATCTTGGCGACAGTTGGGACGGAGTTTGACCTA

    600     .    :    .    :    .    :    .    :    .    :
    791 CGGACGCTGAGGGCAGTTCGAGTGCTGCGGCCGCTCAAGCTGGTGTCTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 134480 CGGACGCTGAGGGCAGTTCGAGTGCTGCGGCCGCTCAAGCTGGTGTCTGG

    650     .    :    .    :    .    :    .    :    .    :
    841 AATCCCAA         GTTTACAAGTCGTCCTGAAGTCGATCATGAAGG
        ||||||||>>>...>>>|||||||||||||||||||||||||||||||||
 134530 AATCCCAAGTG...CAGGTTTACAAGTCGTCCTGAAGTCGATCATGAAGG

    700     .    :    .    :    .    :    .    :    .    :
    882 CGATGATCCCTTTGCTGCAGATCGGCCTCCTCCTATTTTTTGCAATCCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 140789 CGATGATCCCTTTGCTGCAGATCGGCCTCCTCCTATTTTTTGCAATCCTT

    750     .    :    .    :    .    :    .    :    .    :
    932 ATTTTTGCAATCATAGGGTTAGAATTTTATATGGGAAAATTTCATACCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 140839 ATTTTTGCAATCATAGGGTTAGAATTTTATATGGGAAAATTTCATACCAC

    800     .    :    .    :    .    :    .    :    .    :
    982 CTGCTTTGAAGAGGGGACAG         ATGACATTCAGGGTGAGTCTC
        ||||||||||||||||||||>>>...>>>|||||||||||||||||||||
 140889 CTGCTTTGAAGAGGGGACAGGTA...TAGATGACATTCAGGGTGAGTCTC

    850     .    :    .    :    .    :    .    :    .    :
   1023 CGGCTCCATGTGGGACAGAAGAGCCCGCCCGCACCTGCCCCAATGGGACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 146447 CGGCTCCATGTGGGACAGAAGAGCCCGCCCGCACCTGCCCCAATGGGACC

    900     .    :    .    :    .    :    .    :    .    :
   1073 AAATGTCAGCCCTACTGGGAAGGGCCCAACAACGGGATCACTCAGTTCGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 146497 AAATGTCAGCCCTACTGGGAAGGGCCCAACAACGGGATCACTCAGTTCGA

    950     .    :    .    :    .    :    .    :    .    :
   1123 CAACATCCTGTTTGCAGTGCTGACTGTTTTCCAGTGCATAACCATGGAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 146547 CAACATCCTGTTTGCAGTGCTGACTGTTTTCCAGTGCATAACCATGGAAG

   1000     .    :    .    :    .    :    .    :    .    :
   1173 GGTGGACTGATCTCCTCTACAAT         AGCAACGATGCCTCAGGG
        |||||||||||||||||||||||>>>...>>>||||||||||||||||||
 146597 GGTGGACTGATCTCCTCTACAATGTA...CAGAGCAACGATGCCTCAGGG

   1050     .    :    .    :    .    :    .    :    .    :
   1214 AACACTTGGAACTGGTTGTACTTCATCCCCCTCATCATCATCGGCTCCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 170334 AACACTTGGAACTGGTTGTACTTCATCCCCCTCATCATCATCGGCTCCTT

   1100     .    :    .    :    .    :    .    :    .    :
   1264 TTTTATGCTGAACCTTGTGCTGGGTGTGCTGTCAGG         GGAGT
        ||||||||||||||||||||||||||||||||||||>>>...>>>|||||
 170384 TTTTATGCTGAACCTTGTGCTGGGTGTGCTGTCAGGGTA...CAGGGAGT

   1150     .    :    .    :    .    :    .    :    .    :
   1305 TTGCCAAAGAAAGGGAACGGGTGGAGAACCGGCGGGCTTTTCTGAAGCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 171737 TTGCCAAAGAAAGGGAACGGGTGGAGAACCGGCGGGCTTTTCTGAAGCTG

   1200     .    :    .    :    .    :    .    :    .    :
   1355 AGGCGGCAACAACAGATTGAACGTGAGCTCAATGGGTACATGGAATGGAT
        |||||||||||||||||||||||||||||||||||||||||||| |||||
 171787 AGGCGGCAACAACAGATTGAACGTGAGCTCAATGGGTACATGGAGTGGAT

   1250     .    :    .    :    .    :    .    :    .    :
   1405 CTCAAAAGCAG         AAGAGGTGATCCTCGCCGAGGATGAAACTG
        |||||||||||>>>...>>>||||||||||||||||||||||||||||||
 171837 CTCAAAAGCAGGTG...CAGAAGAGGTGATCCTCGCCGAGGATGAAACTG

   1300     .    :    .    :    .    :    .    :    .    :
   1446 ACGGGGAGCAGAGGCATCCCTTTGATG         GAGCTCTGCGGAGA
        |||||||||||||||||||||||||||>>>...>>>||||||||||||||
 173330 ACGGGGAGCAGAGGCATCCCTTTGATGGTA...TTGGAGCTCTGCGGAGA

   1350     .    :    .    :    .    :    .    :    .    :
   1487 ACCACCATAAAGAAAAGCAAGACAGATTTGCTCAACCCCGAAGAGGCTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 175903 ACCACCATAAAGAAAAGCAAGACAGATTTGCTCAACCCCGAAGAGGCTGA

   1400     .    :    .    :    .    :    .    :    .    :
   1537 GGATCAGCTGGCTGATATAGCCTCTGTGG         GTTCTCCCTTCG
        |||||||||||||||||||||||||||||>>>...>>>||||||||||||
 175953 GGATCAGCTGGCTGATATAGCCTCTGTGGGTG...CAGGTTCTCCCTTCG

   1450     .    :    .    :    .    :    .    :    .    :
   1578 CCCGAGCCAGCATTAAAAGTGCCAAGCTGGAGAACTCGACCTTTTTTCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188916 CCCGAGCCAGCATTAAAAGTGCCAAGCTGGAGAACTCGACCTTTTTTCAC

   1500     .    :    .    :    .    :    .    :    .    :
   1628 AAAAAGGAGAGGAGGATGCGTTTCTACATCCGCCGCATGGTCAAAACTCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188966 AAAAAGGAGAGGAGGATGCGTTTCTACATCCGCCGCATGGTCAAAACTCA

   1550     .    :    .    :    .    :    .    :    .    :
   1678 GGCCTTCTACTGGACTGTACTCAGTTTGGTAGCTCTCAACACGCTGTGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 189016 GGCCTTCTACTGGACTGTACTCAGTTTGGTAGCTCTCAACACGCTGTGTG

   1600     .    :    .    :    .    :    .    :    .    :
   1728 TTGCTATTGTTCACTACAACCAGCCCGAGTGGCTCTCCGACTTCCTTT  
        ||||||||||||||||||||||||||||||||||||||||||||||||>>
 189066 TTGCTATTGTTCACTACAACCAGCCCGAGTGGCTCTCCGACTTCCTTTGT

   1650     .    :    .    :    .    :    .    :    .    :
   1776        ACTATGCAGAATTCATTTTCTTAGGACTCTTTATGTCCGAAAT
        >...>>>|||||||||||||||||||||||||||||||||||||||||||
 189116 G...TAGACTATGCAGAATTCATTTTCTTAGGACTCTTTATGTCCGAAAT

   1700     .    :    .    :    .    :    .    :    .    :
   1819 GTTTATAAAAATGTACGGGCTTGGGACGCGGCCTTACTTCCACTCTTCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 193487 GTTTATAAAAATGTACGGGCTTGGGACGCGGCCTTACTTCCACTCTTCCT

   1750     .    :    .    :    .    :    .    :    .    :
   1869 TCAACTGCTTTGACTGTGGG         GTTATCATTGGGAGCATCTTC
        ||||||||||||||||||||>>>...>>>|||||||||||||||||||||
 193537 TCAACTGCTTTGACTGTGGGGTA...TAGGTTATCATTGGGAGCATCTTC

   1800     .    :    .    :    .    :    .    :    .    :
   1910 GAGGTCATCTGGGCTGTCATAAAACCTGGCACATCCTTTGGAATCAGCGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 197718 GAGGTCATCTGGGCTGTCATAAAACCTGGCACATCCTTTGGAATCAGCGT

   1850     .    :    .    :    .    :    .    :    .    :
   1960 GTTACGAGCCCTCAGGTTATTGCGTATTTTCAAAGTCACAAA        
        ||||||||||||||||||||||||||||||||||||||||||>>>...>>
 197768 GTTACGAGCCCTCAGGTTATTGCGTATTTTCAAAGTCACAAAGTA...CA

   1900     .    :    .    :    .    :    .    :    .    :
   2002  GTACTGGGCATCTCTCAGAAACCTGGTCGTCTCTCTCCTCAACTCCATG
        >|||||||||||||||||||||||||||||||||||||||||||||||||
 197973 GGTACTGGGCATCTCTCAGAAACCTGGTCGTCTCTCTCCTCAACTCCATG

   1950     .    :    .    :    .    :    .    :    .    :
   2051 AAGTCCATCATCAGCCTGTTGTTTCTCCTTTTCCTGTTCATTGTCGTCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 198023 AAGTCCATCATCAGCCTGTTGTTTCTCCTTTTCCTGTTCATTGTCGTCTT

   2000     .    :    .    :    .    :    .    :    .    :
   2101 CGCCCTTTTGGGAATGCAACTCTTCGGCGGCCA         GTTTAATT
        |||||||||||||||||||||||||||||||||>>>...>>>||||||||
 198073 CGCCCTTTTGGGAATGCAACTCTTCGGCGGCCAGTA...CAGGTTTAATT

   2050     .    :    .    :    .    :    .    :    .    :
   2142 TCGATGAAGGGACTCCTCCCACCAACTTCGATACTTTTCCAGCAGCAATA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 198379 TCGATGAAGGGACTCCTCCCACCAACTTCGATACTTTTCCAGCAGCAATA

   2100     .    :    .    :    .    :    .    :    .    :
   2192 ATGACGGTGTTTCAG         ATCCTGACGGGCGAAGACTGGAACGA
        |||||||||||||||>>>...>>>||||||||||||||||||||||||||
 198429 ATGACGGTGTTTCAGGTA...CAGATCCTGACGGGCGAAGACTGGAACGA

   2150     .    :    .    :    .    :    .    :    .    :
   2233 GGTCATGTACGACGGGATCAAGTCTCAGGGGGGCGTGCAGGGCGGCATGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 202367 GGTCATGTACGACGGGATCAAGTCTCAGGGGGGCGTGCAGGGCGGCATGG

   2200     .    :    .    :    .    :    .    :    .    :
   2283 TGTTCTCCATCTATTTCATTGTACTGACGCTCTTTGGGAACT        
        ||||||||||||||||||||||||||||||||||||||||||>>>...>>
 202417 TGTTCTCCATCTATTTCATTGTACTGACGCTCTTTGGGAACTGTA...CA

   2250     .    :    .    :    .    :    .    :    .    :
   2325  ACACCCTCCTGAATGTGTTCTTGGCCATCGCTGTGGACAATCTGGCCAA
        >|||||||||||||||||||||||||||||||||||||||||||||||||
 202611 GACACCCTCCTGAATGTGTTCTTGGCCATCGCTGTGGACAATCTGGCCAA

   2300     .    :    .    :    .    :    .    :    .    :
   2374 CGCCCAGGAGCTCACCAAG         GACGAGCAAGAGGAAGAAGAAG
        |||||||||||||||||||>>>...>>>||||||||||||||||||||||
 202661 CGCCCAGGAGCTCACCAAGGTG...TAGGACGAGCAAGAGGAAGAAGAAG

   2350     .    :    .    :    .    :    .    :    .    :
   2415 CAGCGAACCAGAAACTTGCCCTACAGAAAGCCAAGGAGGTGGCAGAAGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 205591 CAGCGAACCAGAAACTTGCCCTACAGAAAGCCAAGGAGGTGGCAGAAGTG

   2400     .    :    .    :    .    :    .    :    .    :
   2465 AGTCCTCTGTCCGCGGCCAACATGTCTATAGCTGT         GAAAGA
        |||||||||||||||||||||||||||||||||||>>>...>>>||||||
 205641 AGTCCTCTGTCCGCGGCCAACATGTCTATAGCTGTGTA...CAGGAAAGA

   2450     .    :    .    :    .    :    .    :    .    :
   2506 GCAACAGAAGAATCAAAAGCCAGCCAAGTCCGTGTGGGAGCAGCGGACCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 206878 GCAACAGAAGAATCAAAAGCCAGCCAAGTCCGTGTGGGAGCAGCGGACCA

   2500     .    :    .    :    .    :    .    :    .    :
   2556 GTGAGATGCGAAAGCAGAACTTGCTGGCCAGCCGGGAGGCCCTGTATAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 206928 GTGAGATGCGAAAGCAGAACTTGCTGGCCAGCCGGGAGGCCCTGTATAAC

   2550     .    :    .    :    .    :    .    :    .    :
   2606 GAAATGGACCCGGACGAGCGCTGGAAGGCTGCCTACACGCGGCACCTGCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 206978 GAAATGGACCCGGACGAGCGCTGGAAGGCTGCCTACACGCGGCACCTGCG

   2600     .    :    .    :    .    :    .    :    .    :
   2656 GCCAGACATGAAGACGCACTTGGACCGGCCGCTGGTGGTGGACCCGCAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207028 GCCAGACATGAAGACGCACTTGGACCGGCCGCTGGTGGTGGACCCGCAGG

   2650     .    :    .    :    .    :    .    :    .    :
   2706 AGAACCGCAACAACAACACCAACAAGAGCCGGGCGGCCGAGCCCACCGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207078 AGAACCGCAACAACAACACCAACAAGAGCCGGGCGGCCGAGCCCACCGTG

   2700     .    :    .    :    .    :    .    :    .    :
   2756 GACCAGCGCCTCGGCCAGCAGCGCGCCGAGGACTTCCTCAGGAAACAGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207128 GACCAGCGCCTCGGCCAGCAGCGCGCCGAGGACTTCCTCAGGAAACAGGC

   2750     .    :    .    :    .    :    .    :    .    :
   2806 CCGCTACCACGATCGGGCCCGGGACCCCAGCGGCTCGGCGGGCCTGGACG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207178 CCGCTACCACGATCGGGCCCGGGACCCCAGCGGCTCGGCGGGCCTGGACG

   2800     .    :    .    :    .    :    .    :    .    :
   2856 CACGGAGGCCCTGGGCGGGAAGCCAGGAGGCCGAGCTGAGCCGGGAGGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207228 CACGGAGGCCCTGGGCGGGAAGCCAGGAGGCCGAGCTGAGCCGGGAGGGA

   2850     .    :    .    :    .    :    .    :    .    :
   2906 CCCTACGGCCGCGAGTCGGACCACCACGCCCGGGAGGGCAGCCTGGAGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207278 CCCTACGGCCGCGAGTCGGACCACCACGCCCGGGAGGGCAGCCTGGAGCA

   2900     .    :    .    :    .    :    .    :    .    :
   2956 ACCCGGGTTCTGGGAGGGCGAGGCCGAGCGAGGCAAGGCCGGGGACCCCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207328 ACCCGGGTTCTGGGAGGGCGAGGCCGAGCGAGGCAAGGCCGGGGACCCCC

   2950     .    :    .    :    .    :    .    :    .    :
   3006 ACCGGAGGCACGTGCACCGGCAGGGGGGCAGCAGGGAGAGCCGCAGCGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207378 ACCGGAGGCACGTGCACCGGCAGGGGGGCAGCAGGGAGAGCCGCAGCGGG

   3000     .    :    .    :    .    :    .    :    .    :
   3056 TCCCCGCGCACGGGCGCGGACGGGGAGCATCGACGTCATCGCGCGCACCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207428 TCCCCGCGCACGGGCGCGGACGGGGAGCATCGACGTCATCGCGCGCACCG

   3050     .    :    .    :    .    :    .    :    .    :
   3106 CAGGCCCGGGGAGGAGGGTCCGGAGGACAAGGCGGAGCGGAGGGCGCGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207478 CAGGCCCGGGGAGGAGGGTCCGGAGGACAAGGCGGAGCGGAGGGCGCGGC

   3100     .    :    .    :    .    :    .    :    .    :
   3156 ACCGCGAGGGCAGCCGGCCGGCCCGGGGCGGCGAGGGCGAGGGCGAGGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207528 ACCGCGAGGGCAGCCGGCCGGCCCGGGGCGGCGAGGGCGAGGGCGAGGGC

   3150     .    :    .    :    .    :    .    :    .    :
   3206 CCCGACGGGGGCGAGCGCAGGAGAAGGCACCGGCATGGCGCTCCAGCCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207578 CCCGACGGGGGCGAGCGCAGGAGAAGGCACCGGCATGGCGCTCCAGCCAC

   3200     .    :    .    :    .    :    .    :    .    :
   3256 GTACGAGGGGGACGCGCGGAGGGAGGACAAGGAGCGGAGGCATCGGAGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207628 GTACGAGGGGGACGCGCGGAGGGAGGACAAGGAGCGGAGGCATCGGAGGA

   3250     .    :    .    :    .    :    .    :    .    :
   3306 GGAA         AGAGAACCAGGGCTCCGGGGTCCCTGTGTCGGGCCCC
        ||||>>>...>>>|||||||||||||||||||||||||||||||||||||
 207678 GGAAGTA...CAGAGAGAACCAGGGCTCCGGGGTCCCTGTGTCGGGCCCC

   3300     .    :    .    :    .    :    .    :    .    :
   3347 AACCTGTCAACCACCCGGCCAATCCAGCAGGACCTGGGCCGCCAAGACCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219296 AACCTGTCAACCACCCGGCCAATCCAGCAGGACCTGGGCCGCCAAGACCC

   3350     .    :    .    :    .    :    .    :    .    :
   3397 ACCCCTGGCAGAGGATATTGACAACATGAAGAACAACAAGCTGGCCACCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219346 ACCCCTGGCAGAGGATATTGACAACATGAAGAACAACAAGCTGGCCACCG

   3400     .    :    .    :    .    :    .    :    .    :
   3447 CGGAGTCGGCCGCTCCCCACGGCAGCCTTGGCCACGCCGGCCTGCCCCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219396 CGGAGTCGGCCGCTCCCCACGGCAGCCTTGGCCACGCCGGCCTGCCCCAG

   3450     .    :    .    :    .    :    .    :    .    :
   3497 AGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCATGCTGGCCAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219446 AGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCATGCTGGCCAT

   3500     .    :    .    :    .    :    .    :    .    :
   3547 CCCTGCCATGGCCACCAACCCCCAGAACGCCGCCAGCCGCCGGACGCCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219496 CCCTGCCATGGCCACCAACCCCCAGAACGCCGCCAGCCGCCGGACGCCCA

   3550     .    :    .    :    .    :    .    :    .    :
   3597 ACAACCCGGGGAACCCATCCAATCCCGGCCCCCCCAAGACCCCCGAGAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219546 ACAACCCGGGGAACCCATCCAATCCCGGCCCCCCCAAGACCCCCGAGAAT

   3600     .    :    .    :    .    :    .    :    .    :
   3647 AGCCTTATCGTCACCAACCCCAGCGGCACCCAGACCAATTCAGCTAAGAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219596 AGCCTTATCGTCACCAACCCCAGCGGCACCCAGACCAATTCAGCTAAGAC

   3650     .    :    .    :    .    :    .    :    .    :
   3697 TGCCAGGAAACCCGACCACACCACAGTGGACATCCCCCCAGCCTGCCCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219646 TGCCAGGAAACCCGACCACACCACAGTGGACATCCCCCCAGCCTGCCCAC

   3700     .    :    .    :    .    :    .    :    .    :
   3747 CCCCCCTCAACCACACCGTCGTACAAG         TGAACAAAAACGCC
        |||||||||||||||||||||||||||>>>...>>>||||||||||||||
 219696 CCCCCCTCAACCACACCGTCGTACAAGGTG...CAGTGAACAAAAACGCC

   3750     .    :    .    :    .    :    .    :    .    :
   3788 AACCCAGACCCACTGCCAAAAAAAGAGGAAGAGAAGAAGGAGGAGGAGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 221033 AACCCAGACCCACTGCCAAAAAAAGAGGAAGAGAAGAAGGAGGAGGAGGA

   3800     .    :    .    :    .    :    .    :    .    :
   3838 AGACGACCGTGGGGAAGACGGCCCTAAGCCAATGCCTCCCTATAGCTCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 221083 AGACGACCGTGGGGAAGACGGCCCTAAGCCAATGCCTCCCTATAGCTCCA

   3850     .    :    .    :    .    :    .    :    .    :
   3888 TGTTCATCCTGTCCACGACCAACCC         CCTTCGCCGCCTGTGC
        |||||||||||||||||||||||||>>>...>>>||||||||||||||||
 221133 TGTTCATCCTGTCCACGACCAACCCGTG...CAGCCTTCGCCGCCTGTGC

   3900     .    :    .    :    .    :    .    :    .    :
   3929 CATTACATCCTGAACCTGCGCTACTTTGAGATGTGCATCCTCATGGTCAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 222845 CATTACATCCTGAACCTGCGCTACTTTGAGATGTGCATCCTCATGGTCAT

   3950     .    :    .    :    .    :    .    :    .    :
   3979 TGCCATGAGCAGCATCGCCCTGGCCGCCGAGGACCCTGTGCAGCCCAACG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 222895 TGCCATGAGCAGCATCGCCCTGGCCGCCGAGGACCCTGTGCAGCCCAACG

   4000     .    :    .    :    .    :    .    :    .    :
   4029 CACCTCGGAACAAC         GTGCTGCGATACTTTGACTACGTTTTT
        ||||||||||||||>>>...>>>|||||||||||||||||||||||||||
 222945 CACCTCGGAACAACGTG...CAGGTGCTGCGATACTTTGACTACGTTTTT

   4050     .    :    .    :    .    :    .    :    .    :
   4070 ACAGGCGTCTTTACCTTTGAGATGGTGATCAAG         ATGATTGA
        |||||||||||||||||||||||||||||||||>>>...>>>||||||||
 229124 ACAGGCGTCTTTACCTTTGAGATGGTGATCAAGGTG...CAGATGATTGA

   4100     .    :    .    :    .    :    .    :    .    :
   4111 CCTGGGGCTCGTCCTGCATCAGGGTGCCTACTTCCGTGACCTCTGGAATA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 230277 CCTGGGGCTCGTCCTGCATCAGGGTGCCTACTTCCGTGACCTCTGGAATA

   4150     .    :    .    :    .    :    .    :    .    :
   4161 TTCTCGACTTCATAGTGGTCAGTGGGGCCCTGGTAGCCTTTGCCTTCAC 
        |||||||||||||||||||||||||||||||||||||||||||||||||>
 230327 TTCTCGACTTCATAGTGGTCAGTGGGGCCCTGGTAGCCTTTGCCTTCACG

   4200     .    :    .    :    .    :    .    :    .    :
   4210         TGGCAATAGCAAAGGAAAAGACATCAACACGATTAAATCCCT
        >>...>>>||||||||||||||||||||||||||||||||||||||||||
 230377 TA...CAGTGGCAATAGCAAAGGAAAAGACATCAACACGATTAAATCCCT

   4250     .    :    .    :    .    :    .    :    .    :
   4252 CCGAGTCCTCCGGGTGCTACGACCTCTTAAAACCATCAAGCGGCTGCCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 243434 CCGAGTCCTCCGGGTGCTACGACCTCTTAAAACCATCAAGCGGCTGCCAA

   4300     .    :    .    :    .    :    .    :    .    :
   4302 AGCTCAAG         GCTGTGTTTGACTGTGTGGTGAACTCACTTAAA
        ||||||||>>>...>>>|||||||||||||||||||||||||||||||||
 243484 AGCTCAAGGTG...CAGGCTGTGTTTGACTGTGTGGTGAACTCACTTAAA

   4350     .    :    .    :    .    :    .    :    .    :
   4343 AACGTCTTCAACATCCTCATCGTCTACATGCTATTCATGTTCATCTTCGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 244648 AACGTCTTCAACATCCTCATCGTCTACATGCTATTCATGTTCATCTTCGC

   4400     .    :    .    :    .    :    .    :    .    :
   4393 CGTGGTGGCTGTGCAGCTCTTCAAGGGGAAATTCTTCCACTGCACTGACG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 244698 CGTGGTGGCTGTGCAGCTCTTCAAGGGGAAATTCTTCCACTGCACTGACG

   4450     .    :    .    :    .    :    .    :    .    :
   4443 AGTCCAAAGAGTTTGAGAAAGATTGTCG         AGGCAAATACCTC
        ||||||||||||||||||||||||||||>>>...>>>|||||||||||||
 244748 AGTCCAAAGAGTTTGAGAAAGATTGTCGGTG...CAGAGGCAAATACCTC

   4500     .    :    .    :    .    :    .    :    .    :
   4484 CTCTACGAGAAGAATGAGGTGAAGGCGCGAGACCGGGAGTGGAAGAAGTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 246537 CTCTACGAGAAGAATGAGGTGAAGGCGCGAGACCGGGAGTGGAAGAAGTA

   4550     .    :    .    :    .    :    .    :    .    :
   4534 TGAATTCCATTACGACAATGTGCTGTGGGCTCTGCTGACCCTCTTCACCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 246587 TGAATTCCATTACGACAATGTGCTGTGGGCTCTGCTGACCCTCTTCACCG

   4600     .    :    .    :    .    :    .    :    .    :
   4584 TGTCCACGGGAGAAGGCTGGCCACA         GGTCCTCAAGCATTCG
        |||||||||||||||||||||||||>>>...>>>||||||||||||||||
 246637 TGTCCACGGGAGAAGGCTGGCCACAGTA...CAGGGTCCTCAAGCATTCG

   4650     .    :    .    :    .    :    .    :    .    :
   4625 GTGGACGCCACCTTTGAGAACCAGGGCCCCAGCCCCGGGTACCGCATGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 248690 GTGGACGCCACCTTTGAGAACCAGGGCCCCAGCCCCGGGTACCGCATGGA

   4700     .    :    .    :    .    :    .    :    .    :
   4675 GATGTCCATTTTCTACGTCGTCTACTTTGTGGTGTTCCCCTTCTTCTTTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 248740 GATGTCCATTTTCTACGTCGTCTACTTTGTGGTGTTCCCCTTCTTCTTTG

   4750     .    :    .    :    .    :    .    :    .    :
   4725 TCAATATCTTTGTGGCCTTGATCATCATCACCTTCCAGGAGCAAGGGGAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 248790 TCAATATCTTTGTGGCCTTGATCATCATCACCTTCCAGGAGCAAGGGGAC

   4800     .    :    .    :    .    :    .    :    .    :
   4775 AAGATGATGGAGGAATACAGCCTGGAGAAAAATGAG         AGGGC
        ||||||||||||||||||||||||||||||||||||>>>...>>>|||||
 248840 AAGATGATGGAGGAATACAGCCTGGAGAAAAATGAGGTG...CAGAGGGC

   4850     .    :    .    :    .    :    .    :    .    :
   4816 CTGCATTGATTTCGCCATCAGCGCCAAGCCGCTGACCCGACACATGCCGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 250971 CTGCATTGATTTCGCCATCAGCGCCAAGCCGCTGACCCGACACATGCCGC

   4900     .    :    .    :    .    :    .    :    .    :
   4866 AGAACAAGCAGAGCTTCCAGTACCGCATGTGGCAGTTCGTGGTGTCTCCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 251021 AGAACAAGCAGAGCTTCCAGTACCGCATGTGGCAGTTCGTGGTGTCTCCG

   4950     .    :    .    :    .    :    .    :    .    :
   4916 CCTTTCGAGTACACGATCATGGCCATGATCGCCCTCAACACCATCGTGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 251071 CCTTTCGAGTACACGATCATGGCCATGATCGCCCTCAACACCATCGTGCT

   5000     .    :    .    :    .    :    .    :    .    :
   4966 TATGATGAAG         TTCTATGGGGCTTCTGTTGCTTATGAAAATG
        ||||||||||>>>...>>>|||||||||||||||||||||||||||||||
 251121 TATGATGAAGGTA...TAGTTCTATGGGGCTTCTGTTGCTTATGAAAATG

   5050     .    :    .    :    .    :    .    :    .    :
   5007 CCCTGCGGGTGTTCAACATCGTCTTCACCTCCCTCTTCTCTCTGGAATGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 253155 CCCTGCGGGTGTTCAACATCGTCTTCACCTCCCTCTTCTCTCTGGAATGT

   5100     .    :    .    :    .    :    .    :    .    :
   5057 GTGCTGAAAGTCATGGCTTTTGGGATTCTG         AATTATTTCCG
        ||||||||||||||||||||||||||||||>>>...>>>|||||||||||
 253205 GTGCTGAAAGTCATGGCTTTTGGGATTCTGGTA...TAGAATTATTTCCG

   5150     .    :    .    :    .    :    .    :    .    :
   5098 CGATGCCTGGAACATCTTCGACTTTGTGACTGTTCTGGGCAGCATCACCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 260971 CGATGCCTGGAACATCTTCGACTTTGTGACTGTTCTGGGCAGCATCACCG

   5200     .    :    .    :    .    :    .    :    .    :
   5148 ATATCCTCGTGACTGAGTTTGGG         AATAACTTCATCAACCTG
        |||||||||||||||||||||||>>>...>>>||||||||||||||||||
 261021 ATATCCTCGTGACTGAGTTTGGGGTA...CAGAATAACTTCATCAACCTG

   5250     .    :    .    :    .    :    .    :    .    :
   5189 AGCTTTCTCCGCCTCTTCCGAGCTGCCCGGCTCATCAAACTTCTCCGTCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 270513 AGCTTTCTCCGCCTCTTCCGAGCTGCCCGGCTCATCAAACTTCTCCGTCA

   5300     .    :    .    :    .    :    .    :    .    :
   5239 GGGTTACACCATCCGCATTCTTCTCTGGACCTTTGTGCAGTCCTTCAAG 
        |||||||||||||||||||||||||||||||||||||||||||||||||>
 270563 GGGTTACACCATCCGCATTCTTCTCTGGACCTTTGTGCAGTCCTTCAAGG

   5350     .    :    .    :    .    :    .    :    .    :
   5288         GCCCTGCCTTATGTCTGTCTGCTGATCGCCATGCTCTTCTTC
        >>...>>>||||||||||||||||||||||||||||||||||||||||||
 270613 TG...CAGGCCCTGCCTTATGTCTGTCTGCTGATCGCCATGCTCTTCTTC

   5400     .    :    .    :    .    :    .    :    .    :
   5330 ATCTATGCCATCATTGGGATGCAG         GTGTTTGGTAACATTGG
        ||||||||||||||||||||||||>>>...>>>|||||||||||||||||
 270993 ATCTATGCCATCATTGGGATGCAGGTG...CAGGTGTTTGGTAACATTGG

   5450     .    :    .    :    .    :    .    :    .    :
   5371 CATCGACGTGGAGGACGAGGACAGTGATGAAGATGAGTTCCAAATCACTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 271206 CATCGACGTGGAGGACGAGGACAGTGATGAAGATGAGTTCCAAATCACTG

   5500     .    :    .    :    .    :    .    :    .    :
   5421 AGCACAATAACTTCCGGACCTTCTTCCAGGCCCTCATGCTTCTCTTCCG 
        |||||||||||||||||||||||||||||||||||||||||||||||||>
 271256 AGCACAATAACTTCCGGACCTTCTTCCAGGCCCTCATGCTTCTCTTCCGG

   5550     .    :    .    :    .    :    .    :    .    :
   5470         GAGTGCCACCGGGGAAGCTTGGCACAACATCATGCTTTCCTG
        >>...>>>||||||||||||||||||||||||||||||||||||||||||
 271306 TG...CAGGAGTGCCACCGGGGAAGCTTGGCACAACATCATGCTTTCCTG

   5600     .    :    .    :    .    :    .    :    .    :
   5512 CCTCAGCGGGAAACCGTGTGATAAGAACTCTGGCATCCTGACTCGAGAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 274407 CCTCAGCGGGAAACCGTGTGATAAGAACTCTGGCATCCTGACTCGAGAGT

   5650     .    :    .    :    .    :    .    :    .    :
   5562 GTGGCAATGAATTTGCTTATTTTTACTTTGTTTCCTTCATCTTCCTCTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 274457 GTGGCAATGAATTTGCTTATTTTTACTTTGTTTCCTTCATCTTCCTCTGC

   5700     .    :    .    :    .    :    .    :    .    :
   5612 TCGTTTCTG         ATGCTGAATCTCTTTGTCGCCGTCATCATGGA
        |||||||||>>>...>>>||||||||||||||||||||||||||||||||
 274507 TCGTTTCTGGTG...CAGATGCTGAATCTCTTTGTCGCCGTCATCATGGA

   5750     .    :    .    :    .    :    .    :    .    :
   5653 CAACTTTGAGTACCTCACCCGAGACTCCTCCATCCTGGGCCCCCACCACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 276048 CAACTTTGAGTACCTCACCCGAGACTCCTCCATCCTGGGCCCCCACCACC

   5800     .    :    .    :    .    :    .    :    .    :
   5703 TGGATGAGTACGTGCGTGTCTGGGCCGAGTATGACCCCGCAGCTTG    
        ||||||||||||||||||||||||||||||||||||||||||||||>>>.
 276098 TGGATGAGTACGTGCGTGTCTGGGCCGAGTATGACCCCGCAGCTTGGTA.

   5850     .    :    .    :    .    :    .    :    .    :
   5749      CGGTCGGATTCATTATAAGGATATGTACAGTTTATTACGAGTAAT
        ..>>>|||||||||||||||||||||||||||||||||||||||||||||
 276148 ..CAGCGGTCGGATTCATTATAAGGATATGTACAGTTTATTACGAGTAAT

   5900     .    :    .    :    .    :    .    :    .    :
   5794 ATCTCCCCCTCTCGGCTTAGGCAAGAAATGTCCTCATAGGGTTGCTTGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 277475 ATCTCCCCCTCTCGGCTTAGGCAAGAAATGTCCTCATAGGGTTGCTTGCA

   5950     .    :    .    :    .    :    .    :    .    :
   5844 AG         CGGCTTCTGCGGATGGACCTGCCCGTCGCAGATGACAAC
        ||>>>...>>>|||||||||||||||||||||||||||||||||||||||
 277525 AGGTT...TAGCGGCTTCTGCGGATGGACCTGCCCGTCGCAGATGACAAC

   6000     .    :    .    :    .    :    .    :    .    :
   5885 ACCGTCCACTTCAATTCCACCCTCATGGCTCTGATCCGCACAGCCCTGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 281492 ACCGTCCACTTCAATTCCACCCTCATGGCTCTGATCCGCACAGCCCTGGA

   6050     .    :    .    :    .    :    .    :    .    :
   5935 CATCAAGATTGCCAAGG         GAGGAGCCGACAAACAGCAGATGG
        |||||||||||||||||>>>...>>>||||||||||||||||||||||||
 281542 CATCAAGATTGCCAAGGGTA...CAGGAGGAGCCGACAAACAGCAGATGG

   6100     .    :    .    :    .    :    .    :    .    :
   5976 ACGCTGAGCTGCGGAAGGAGATGATGGCGATTTGGCCCAATCTGTCCCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 291641 ACGCTGAGCTGCGGAAGGAGATGATGGCGATTTGGCCCAATCTGTCCCAG

   6150     .    :    .    :    .    :    .    :    .    :
   6026 AAGACGCTAGACCTGCTGGTCACACCTCACAAGT         CCACGGA
        ||||||||||||||||||||||||||||||||||>>>...>>>|||||||
 291691 AAGACGCTAGACCTGCTGGTCACACCTCACAAGTGTA...CAGCCACGGA

   6200     .    :    .    :    .    :    .    :    .    :
   6067 CCTCACCGTGGGGAAGATCTACGCAGCCATGATGATCATGGAGTACTACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 291899 CCTCACCGTGGGGAAGATCTACGCAGCCATGATGATCATGGAGTACTACC

   6250     .    :    .    :    .    :    .    :    .    :
   6117 GGCAGAGCAAGGCCAAGAAGCTGCAGGCCATGCGCGAGGAGCAG      
        ||||||||||||||||||||||||||||||||||||||||||||>>>...
 291949 GGCAGAGCAAGGCCAAGAAGCTGCAGGCCATGCGCGAGGAGCAGGTG...

   6300     .    :    .    :    .    :    .    :    .    :
   6161    GACCGGACACCCCTCATGTTCCAGCGCATGGAGCCCCCGTCCCCAAC
        >>>|||||||||||||||||||||||||||||||||||||||||||||||
 293482 CAGGACCGGACACCCCTCATGTTCCAGCGCATGGAGCCCCCGTCCCCAAC

   6350     .    :    .    :    .    :    .    :    .    :
   6208 GCAGGAAGGGGGACCTGGCCAGAACGCCCTCCCCTCCACCCAGCTGGACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 293532 GCAGGAAGGGGGACCTGGCCAGAACGCCCTCCCCTCCACCCAGCTGGACC

   6400     .    :    .    :    .    :    .    :    .    :
   6258 CAGGAGGAGCCCT         GATGGCTCACGAAAGCGGCCTCAAGGAG
        |||||||||||||>>>...>>>||||||||||||||||||||||||||||
 293582 CAGGAGGAGCCCTGTG...CAGGATGGCTCACGAAAGCGGCCTCAAGGAG

   6450     .    :    .    :    .    :    .    :    .    :
   6299 AGCCCGTCCTGGGTGACCCAGCGTGCCCAGGAGATGTTCCAGAAGACGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 293731 AGCCCGTCCTGGGTGACCCAGCGTGCCCAGGAGATGTTCCAGAAGACGGG

   6500     .    :    .    :    .    :    .    :    .    :
   6349 CACATGGAGTCCGGAACAAGGCCCCCCTACCGACATGCCCAACAGCCAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 293781 CACATGGAGTCCGGAACAAGGCCCCCCTACCGACATGCCCAACAGCCAGC

   6550     .    :    .    :    .    :    .    :    .    :
   6399 CTAACTCTCAG         TCCGTGGAGATGCGAGAGATGGGCAGAGAT
        |||||||||||>>>...>>>||||||||||||||||||||||||||||||
 293831 CTAACTCTCAGGTG...CAGTCCGTGGAGATGCGAGAGATGGGCAGAGAT

   6600     .    :    .    :    .    :    .    :    .    :
   6440 GGCTACTCCGACAGCGAGCACTACCTCCCCATGGAAGGCCAGGGCCGGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 294039 GGCTACTCCGACAGCGAGCACTACCTCCCCATGGAAGGCCAGGGCCGGGC

   6650     .    :    .    :    .    :    .    :    .    :
   6490 TGCCTCCATGCCCCGCCTCCCTGCAGAGAACCAG         AGGAGAA
        ||||||||||||||||||||||||||||||||||>>>...>>>|||||||
 294089 TGCCTCCATGCCCCGCCTCCCTGCAGAGAACCAGGTG...CAGAGGAGAA

   6700     .    :    .    :    .    :    .    :    .    :
   6531 GGGGCCGGCCACGTGGGAATAACCTCAGT         ACCATCTCAGAC
        |||||||||||||||||||||||||||||>>>...>>>||||||||||||
 295580 GGGGCCGGCCACGTGGGAATAACCTCAGTGTA...CAGACCATCTCAGAC

   6750     .    :    .    :    .    :    .    :    .    :
   6572 ACCAGCCCCATGAAGCGTTCAGCCTCCGTGCTGGGCCCCAAGGCCCGACG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 296739 ACCAGCCCCATGAAGCGTTCAGCCTCCGTGCTGGGCCCCAAGGCCCGACG

   6800     .    :    .    :    .    :    .    :    .    :
   6622 CCTGGACGATTACTCGCTGGAGCGGGTCCCGCCCGAGGAGAACCAGCGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 296789 CCTGGACGATTACTCGCTGGAGCGGGTCCCGCCCGAGGAGAACCAGCGGC

   6850     .    :    .    :    .    :    .    :    .    :
   6672 ACCACCAGCGGCGCCGCGACCGCAGCCACCGCGCCTCTGAGCGCTCCCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 296839 ACCACCAGCGGCGCCGCGACCGCAGCCACCGCGCCTCTGAGCGCTCCCTG

   6900     .    :    .    :    .    :    .    :    .    :
   6722 GGCCGCTACACCGATGTGGACACAG         GCTTGGGGACAGACCT
        |||||||||||||||||||||||||>>>...>>>||||||||||||||||
 296889 GGCCGCTACACCGATGTGGACACAGGTG...CAGGCTTGGGGACAGACCT

   6950     .    :    .    :    .    :    .    :    .    :
   6763 GAGCATGACCACCCAATCCGGGGACCTGCCGTCGAAGGAGCGGGACCAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 297232 GAGCATGACCACCCAATCCGGGGACCTGCCGTCGAAGGAGCGGGACCAGG

   7000     .    :    .    :    .    :    .    :    .    :
   6813 AGCGGGGCCGGCCCAAGGATCGGAAGCATCGACAGCACCACCACCACCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 297282 AGCGGGGCCGGCCCAAGGATCGGAAGCATCGACAGCACCACCACCACCAC

   7050     .    :    .    :    .    :    .    :    .    :
   6863 CACCACCACCACCATCCCCCGCCCCCCGACAAGGACCGCTATGCCCAGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 297332 CACCACCACCACCATCCCCCGCCCCCCGACAAGGACCGCTATGCCCAGGA

   7100     .    :    .    :    .    :    .    :    .    :
   6913 ACGGCCGGACCACGGCCGGGCACGGGCTCGGGACCAGCGCTGGTCCCGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 297382 ACGGCCGGACCACGGCCGGGCACGGGCTCGGGACCAGCGCTGGTCCCGCT

   7150     .    :    .    :    .    :    .    :    .    :
   6963 CGCCCAGCGAGGGCCGAGAGCACATGGCGCACCGGCAG         GGC
        ||||||||||||||||||||||||||||||||||||||>>>...>>>|||
 297432 CGCCCAGCGAGGGCCGAGAGCACATGGCGCACCGGCAGGTG...TAGGGC

   7200     .    :    .    :    .    :    .    :    .    :
   7004 AGTAGTTCCGTAAGTGGAAGCCCAGCCCCCTCAACATCTGGTACCAGCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298175 AGTAGTTCCGTAAGTGGAAGCCCAGCCCCCTCAACATCTGGTACCAGCAC

   7250     .    :    .    :    .    :    .    :    .    :
   7054 TCCGCGGCGGGGCCGCCGCCAGCTCCCCCAGACCCCCTCCACCCCCCGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298225 TCCGCGGCGGGGCCGCCGCCAGCTCCCCCAGACCCCCTCCACCCCCCGGC

   7300     .    :    .    :    .    :    .    :    .    :
   7104 CACACGTGTCCTATTCCCCTGTGATCCGTAAGGCCGGCGGCTCGGGGCCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298275 CACACGTGTCCTATTCCCCTGTGATCCGTAAGGCCGGCGGCTCGGGGCCC

   7350     .    :    .    :    .    :    .    :    .    :
   7154    C  C GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGGCGGTGGC
        ---|--|-||||||||||||||||||||||||||||||||||||||||||
 298325 CCGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGGCGGTGGC

   7400     .    :    .    :    .    :    .    :    .    :
   7198 CAGGCCGGGCCGGGCGGCCACCAGCGGCCCTCGGAGGTACCCAGGCCCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298375 CAGGCCGGGCCGGGCGGCCACCAGCGGCCCTCGGAGGTACCCAGGCCCCA

   7450     .    :    .    :    .    :    .    :    .    :
   7248 CGGCCGAGCCTCTGGCCGGAGATCGGCCGCCCACGGGGGGCCACAGCAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298425 CGGCCGAGCCTCTGGCCGGAGATCGGCCGCCCACGGGGGGCCACAGCAGC

   7500     .    :    .    :    .    :    .    :    .    :
   7298 GGCCGCTCGCCCAGGATGGAGAGGCGGGTCCCAGGCCCGGCCCGGAGCGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298475 GGCCGCTCGCCCAGGATGGAGAGGCGGGTCCCAGGCCCGGCCCGGAGCGA

   7550     .    :    .    :    .    :    .    :    .    :
   7348 GTCCCCCAGGGCCTGTCGACACGGCGGGGCCCGGTGGCCGGCATCTGGCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298525 GTCCCCCAGGGCCTGTCGACACGGCGGGGCCCGGTGGCCGGCATCTGGCC

   7600     .    :    .    :    .    :    .    :    .    :
   7398 CGCACGTGTCCGAGGGGCCCCCGGGTCCCCGGCACCATGGCTACTACCGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298575 CGCACGTGTCCGAGGGGCCCCCGGGTCCCCGGCACCATGGCTACTACCGG

   7650     .    :    .    :    .    :    .    :    .    :
   7448 GGCTCCGACTACGACGAGGCCGATGGCCCGGGCAGCGGGGGCGGCGAGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298625 GGCTCCGACTACGACGAGGCCGATGGCCCGGGCAGCGGGGGCGGCGAGGA

   7700     .    :    .    :    .    :    .    :    .    :
   7498 GGCCATGGCCGGGGCCTACGACGCGCCACCCCCCGTACGACACGCGTCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298675 GGCCATGGCCGGGGCCTACGACGCGCCACCCCCCGTACGACACGCGTCCT

   7750     .    :    .    :    .    :    .    :    .    :
   7548 CGGGCGCCACCGGGCGCTCGCCCAGGACTCCCCGGGCCTCGGGCCCGGCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298725 CGGGCGCCACCGGGCGCTCGCCCAGGACTCCCCGGGCCTCGGGCCCGGCC

   7800     .    :    .    :    .    :    .    :    .    :
   7598 TGCGCCTCGCCTTCTCGGCACGGCCGGCGACTCCCCAACGGCTACTACCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298775 TGCGCCTCGCCTTCTCGGCACGGCCGGCGACTCCCCAACGGCTACTACCC

   7850     .    :    .    :    .    :    .    :    .    :
   7648 GGCGCACGGACTGGCCAGGCCCCGCGGGCCGGGCTCCAGGAAGGGCCTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298825 GGCGCACGGACTGGCCAGGCCCCGCGGGCCGGGCTCCAGGAAGGGCCTGC

   7900     .    :    .    :    .    :    .    :    .    :
   7698 ACGAACCCTACAGCGAGAGTGACGATGATTGGTGCTAAGCCCGGGCGAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298875 ACGAACCCTACAGCGAGAGTGACGATGATTGGTGCTAAGCCCGGGCGAGG

END