Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: U64805.1
Subject Sequence ID: ENSG00000012048
Subject Sequence type: 2


seq1 = /RAID/mart2/Splice/web_temp/fasta/U64805.1, 2280 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000012048 (ENSG00000012048), 81091 bp

>gi|1498736|gb|U64805.1|HSU64805 Homo sapiens Brca1-delta11b (Brca1) mRNA, complete cds
>ENSG00000012048

(complement)

1-80  (1296-1375)   100% ==
135-212  (18859-18936)   100% ->
213-301  (20436-20524)   100% ->
302-441  (21131-21270)   100% ->
442-547  (25512-25617)   100% ->
548-593  (28103-28148)   100% ->
594-670  (29470-29546)   100% ->
671-787  (30532-30648)   98% ->
788-876  (34360-34448)   100% ->
877-1048  (42817-42988)   98% ->
1049-1172  (48781-48904)   100% ->
1173-1363  (50871-51061)   100% ->
1364-1674  (54154-54464)   99% ->
1675-1762  (57697-57784)   100% ->
1763-1840  (61441-61518)   100% ->
1841-1881  (62019-62059)   100% ->
1882-1965  (68257-68340)   100% ->
1966-2020  (74275-74329)   100% ->
2021-2094  (76198-76271)   100% ->
2095-2155  (77689-77749)   100% ->
2156-2280  (79590-79714)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 ATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   1296 ATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGC

     50     .    :    .    :    .    :
     51 TATGCAGAAAATCTTAGAGTGTCCCATCTG
        ||||||||||||||||||||||||||||||
   1346 TATGCAGAAAATCTTAGAGTGTCCCATCTG

      0     .    :    .    :    .    :    .    :    .    :
    135 ATTTTGCATGCTGAAACTTCTCAACCAGAAGAAAGGGCCTTCACAGTGTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  18859 ATTTTGCATGCTGAAACTTCTCAACCAGAAGAAAGGGCCTTCACAGTGTC

     50     .    :    .    :    .    :    .    :    .    :
    185 CTTTATGTAAGAATGATATAACCAAAAG         GAGCCTACAAGAA
        ||||||||||||||||||||||||||||>>>...>>>|||||||||||||
  18909 CTTTATGTAAGAATGATATAACCAAAAGGTA...CAGGAGCCTACAAGAA

    100     .    :    .    :    .    :    .    :    .    :
    226 AGTACGAGATTTAGTCAACTTGTTGAAGAGCTATTGAAAATCATTTGTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  20449 AGTACGAGATTTAGTCAACTTGTTGAAGAGCTATTGAAAATCATTTGTGC

    150     .    :    .    :    .    :    .    :    .    :
    276 TTTTCAGCTTGACACAGGTTTGGAGT         ATGCAAACAGCTATA
        ||||||||||||||||||||||||||>>>...>>>|||||||||||||||
  20499 TTTTCAGCTTGACACAGGTTTGGAGTGTA...CAGATGCAAACAGCTATA

    200     .    :    .    :    .    :    .    :    .    :
    317 ATTTTGCAAAAAAGGAAAATAACTCTCCTGAACATCTAAAAGATGAAGTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  21146 ATTTTGCAAAAAAGGAAAATAACTCTCCTGAACATCTAAAAGATGAAGTT

    250     .    :    .    :    .    :    .    :    .    :
    367 TCTATCATCCAAAGTATGGGCTACAGAAACCGTGCCAAAAGACTTCTACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  21196 TCTATCATCCAAAGTATGGGCTACAGAAACCGTGCCAAAAGACTTCTACA

    300     .    :    .    :    .    :    .    :    .    :
    417 GAGTGAACCCGAAAATCCTTCCTTG         CAGGAAACCAGTCTCA
        |||||||||||||||||||||||||>>>...>>>||||||||||||||||
  21246 GAGTGAACCCGAAAATCCTTCCTTGGTA...TAGCAGGAAACCAGTCTCA

    350     .    :    .    :    .    :    .    :    .    :
    458 GTGTCCAACTCTCTAACCTTGGAACTGTGAGAACTCTGAGGACAAAGCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  25528 GTGTCCAACTCTCTAACCTTGGAACTGTGAGAACTCTGAGGACAAAGCAG

    400     .    :    .    :    .    :    .    :    .    :
    508 CGGATACAACCTCAAAAGACGTCTGTCTACATTGAATTGG         G
        ||||||||||||||||||||||||||||||||||||||||>>>...>>>|
  25578 CGGATACAACCTCAAAAGACGTCTGTCTACATTGAATTGGGTA...TAGG

    450     .    :    .    :    .    :    .    :    .    :
    549 ATCTGATTCTTCTGAAGATACCGTTAATAAGGCAACTTATTGCAG     
        |||||||||||||||||||||||||||||||||||||||||||||>>>..
  28104 ATCTGATTCTTCTGAAGATACCGTTAATAAGGCAACTTATTGCAGGTG..

    500     .    :    .    :    .    :    .    :    .    :
    594     TGTGGGAGATCAAGAATTGTTACAAATCACCCCTCAAGGAACCAGG
        .>>>||||||||||||||||||||||||||||||||||||||||||||||
  28154 .TAGTGTGGGAGATCAAGAATTGTTACAAATCACCCCTCAAGGAACCAGG

    550     .    :    .    :    .    :    .    :    .    :
    640 GATGAAATCAGTTTGGATTCTGCAAAAAAGG         CTGCTTGTGA
        |||||||||||||||||||||||||||||||>>>...>>>||||||||||
  29516 GATGAAATCAGTTTGGATTCTGCAAAAAAGGGTA...CAGCTGCTTGTGA

    600     .    :    .    :    .    :    .    :    .    :
    681 ATTTTCTGAGACGGATGTAACAAATACTGAACATCGTCAACCCAGTAATA
        ||||||||||||||||||||||||||||||||||| ||||||||||||||
  30542 ATTTTCTGAGACGGATGTAACAAATACTGAACATCATCAACCCAGTAATA

    650     .    :    .    :    .    :    .    :    .    :
    731 ATGATTTGAACACCACTGAGAAGCGTGTAGCTGAGAGGCATCCAGAAAAG
        ||||||||||||||||||||||||||| ||||||||||||||||||||||
  30592 ATGATTTGAACACCACTGAGAAGCGTGCAGCTGAGAGGCATCCAGAAAAG

    700     .    :    .    :    .    :    .    :    .    :
    781 TATCAGG         GTGAAGCAGCATCTGGGTGTGAGAGTGAAACAAG
        |||||||>>>...>>>||||||||||||||||||||||||||||||||||
  30642 TATCAGGGTA...AAGGTGAAGCAGCATCTGGGTGTGAGAGTGAAACAAG

    750     .    :    .    :    .    :    .    :    .    :
    822 CGTCTCTGAAGACTGCTCAGGGCTATCCTCTCAGAGTGACATTTTAACCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  34394 CGTCTCTGAAGACTGCTCAGGGCTATCCTCTCAGAGTGACATTTTAACCA

    800     .    :    .    :    .    :    .    :    .    :
    872 CTCAG         CAGAGGGATACCATGCAACATAACCTGATAAAGCTC
        |||||>>>...>>>||||||||||||||||||||||||||||||||||||
  34444 CTCAGGTA...AAGCAGAGGGATACCATGCAACATAACCTGATAAAGCTC

    850     .    :    .    :    .    :    .    :    .    :
    913 CAGCAGGAAATGGCTGAACTAGAAGCTGTGTTAGAACAGCATGGGAGCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  42853 CAGCAGGAAATGGCTGAACTAGAAGCTGTGTTAGAACAGCATGGGAGCCA

    900     .    :    .    :    .    :    .    :    .    :
    963 GCCTCCTAACAGCTACCCTTCCATCATAAGTGACTCCTCTGCCCTTGAGG
        |||| ||||||||||||||||||||||||||||||| |||||||||||||
  42903 GCCTTCTAACAGCTACCCTTCCATCATAAGTGACTCTTCTGCCCTTGAGG

    950     .    :    .    :    .    :    .    :    .    :
   1013 ACCTGCGAAATCCAGAACAAAGCACATCAGAAAAAG         TATTA
        ||||||||||||||||||||||||||||||||||||>>>...>>>|||||
  42953 ACCTGCGAAATCCAGAACAAAGCACATCAGAAAAAGGTG...CAGTATTA

   1000     .    :    .    :    .    :    .    :    .    :
   1054 ACTTCACAGAAAAGTAGTGAATACCCTATAAGCCAGAATCCAGAAGGCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  48786 ACTTCACAGAAAAGTAGTGAATACCCTATAAGCCAGAATCCAGAAGGCCT

   1050     .    :    .    :    .    :    .    :    .    :
   1104 TTCTGCTGACAAGTTTGAGGTGTCTGCAGATAGTTCTACCAGTAAAAATA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  48836 TTCTGCTGACAAGTTTGAGGTGTCTGCAGATAGTTCTACCAGTAAAAATA

   1100     .    :    .    :    .    :    .    :    .    :
   1154 AAGAACCAGGAGTGGAAAG         GTCATCCCCTTCTAAATGCCCA
        |||||||||||||||||||>>>...>>>||||||||||||||||||||||
  48886 AAGAACCAGGAGTGGAAAGGTA...TAGGTCATCCCCTTCTAAATGCCCA

   1150     .    :    .    :    .    :    .    :    .    :
   1195 TCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  50893 TCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAGAA

   1200     .    :    .    :    .    :    .    :    .    :
   1245 TAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  50943 TAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGG

   1250     .    :    .    :    .    :    .    :    .    :
   1295 AGCAACAGCTGGAAGAGTCTGGGCCACACGATTTGACGGAAACATCTTAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  50993 AGCAACAGCTGGAAGAGTCTGGGCCACACGATTTGACGGAAACATCTTAC

   1300     .    :    .    :    .    :    .    :    .    :
   1345 TTGCCAAGGCAAGATCTAG         AGGGAACCCCTTACCTGGAATC
        |||||||||||||||||||>>>...>>>||||||||||||||||||||||
  51043 TTGCCAAGGCAAGATCTAGGTA...CAGAGGGAACCCCTTACCTGGAATC

   1350     .    :    .    :    .    :    .    :    .    :
   1386 TGGAATCAGCCTCTTCTCTGATGACCCTGAATCTGATCCTTCTGAAGACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54176 TGGAATCAGCCTCTTCTCTGATGACCCTGAATCTGATCCTTCTGAAGACA

   1400     .    :    .    :    .    :    .    :    .    :
   1436 GAGCCCCAGAGTCAGCTCGTGTTGGCAACATACCATCTTCAACCTCTGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54226 GAGCCCCAGAGTCAGCTCGTGTTGGCAACATACCATCTTCAACCTCTGCA

   1450     .    :    .    :    .    :    .    :    .    :
   1486 TTGAAAGTTCCCCAATTGAAAGTTGCAGAATCTGCCCAGGGTCCAGCTGC
        ||||||||||||||||||||||||||||||||||||||| ||||||||||
  54276 TTGAAAGTTCCCCAATTGAAAGTTGCAGAATCTGCCCAGAGTCCAGCTGC

   1500     .    :    .    :    .    :    .    :    .    :
   1536 TGCTCATACTACTGATACTGCTGGGTATAATGCAATGGAAGAAAGTGTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54326 TGCTCATACTACTGATACTGCTGGGTATAATGCAATGGAAGAAAGTGTGA

   1550     .    :    .    :    .    :    .    :    .    :
   1586 GCAGGGAGAAGCCAGAATTGACAGCTTCAACAGAAAGGGTCAACAAAAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54376 GCAGGGAGAAGCCAGAATTGACAGCTTCAACAGAAAGGGTCAACAAAAGA

   1600     .    :    .    :    .    :    .    :    .    :
   1636 ATGTCCATGGTGGTGTCTGGCCTGACCCCAGAAGAATTT         AT
        |||||||||||||||||||||||||||||||||||||||>>>...>>>||
  54426 ATGTCCATGGTGGTGTCTGGCCTGACCCCAGAAGAATTTGTG...CAGAT

   1650     .    :    .    :    .    :    .    :    .    :
   1677 GCTCGTGTACAAGTTTGCCAGAAAACACCACATCACTTTAACTAATCTAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  57699 GCTCGTGTACAAGTTTGCCAGAAAACACCACATCACTTTAACTAATCTAA

   1700     .    :    .    :    .    :    .    :    .    :
   1727 TTACTGAAGAGACTACTCATGTTGTTATGAAAACAG         ATGCT
        ||||||||||||||||||||||||||||||||||||>>>...>>>|||||
  57749 TTACTGAAGAGACTACTCATGTTGTTATGAAAACAGGTA...CAGATGCT

   1750     .    :    .    :    .    :    .    :    .    :
   1768 GAGTTTGTGTGTGAACGGACACTGAAATATTTTCTAGGAATTGCGGGAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  61446 GAGTTTGTGTGTGAACGGACACTGAAATATTTTCTAGGAATTGCGGGAGG

   1800     .    :    .    :    .    :    .    :    .    :
   1818 AAAATGGGTAGTTAGCTATTTCT         GGGTGACCCAGTCTATTA
        |||||||||||||||||||||||>>>...>>>||||||||||||||||||
  61496 AAAATGGGTAGTTAGCTATTTCTGTA...TAGGGGTGACCCAGTCTATTA

   1850     .    :    .    :    .    :    .    :    .    :
   1859 AAGAAAGAAAAATGCTGAATGAG         CATGATTTTGAAGTCAGA
        |||||||||||||||||||||||>>>...>>>||||||||||||||||||
  62037 AAGAAAGAAAAATGCTGAATGAGGTA...CAGCATGATTTTGAAGTCAGA

   1900     .    :    .    :    .    :    .    :    .    :
   1900 GGAGATGTGGTCAATGGAAGAAACCACCAAGGTCCAAAGCGAGCAAGAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  68275 GGAGATGTGGTCAATGGAAGAAACCACCAAGGTCCAAAGCGAGCAAGAGA

   1950     .    :    .    :    .    :    .    :    .    :
   1950 ATCCCAGGACAGAAAG         ATCTTCAGGGGGCTAGAAATCTGTT
        ||||||||||||||||>>>...>>>|||||||||||||||||||||||||
  68325 ATCCCAGGACAGAAAGGTA...CAGATCTTCAGGGGGCTAGAAATCTGTT

   2000     .    :    .    :    .    :    .    :    .    :
   1991 GCTATGGGCCCTTCACCAACATGCCCACAG         ATCAACTGGAA
        ||||||||||||||||||||||||||||||>>>...>>>|||||||||||
  74300 GCTATGGGCCCTTCACCAACATGCCCACAGGTA...TAGATCAACTGGAA

   2050     .    :    .    :    .    :    .    :    .    :
   2032 TGGATGGTACAGCTGTGTGGTGCTTCTGTGGTGAAGGAGCTTTCATCATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  76209 TGGATGGTACAGCTGTGTGGTGCTTCTGTGGTGAAGGAGCTTTCATCATT

   2100     .    :    .    :    .    :    .    :    .    :
   2082 CACCCTTGGCACA         GGTGTCCACCCAATTGTGGTTGTGCAGC
        |||||||||||||>>>...>>>||||||||||||||||||||||||||||
  76259 CACCCTTGGCACAGTA...CAGGGTGTCCACCCAATTGTGGTTGTGCAGC

   2150     .    :    .    :    .    :    .    :    .    :
   2123 CAGATGCCTGGACAGAGGACAATGGCTTCCATG         CAATTGGG
        |||||||||||||||||||||||||||||||||>>>...>>>||||||||
  77717 CAGATGCCTGGACAGAGGACAATGGCTTCCATGGTA...CAGCAATTGGG

   2200     .    :    .    :    .    :    .    :    .    :
   2164 CAGATGTGTGAGGCACCTGTGGTGACCCGAGAGTGGGTGTTGGACAGTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79598 CAGATGTGTGAGGCACCTGTGGTGACCCGAGAGTGGGTGTTGGACAGTGT

   2250     .    :    .    :    .    :    .    :    .    :
   2214 AGCACTCTACCAGTGCCAGGAGCTGGACACCTACCTGATACCCCAGATCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79648 AGCACTCTACCAGTGCCAGGAGCTGGACACCTACCTGATACCCCAGATCC

   2300     .    :    .
   2264 CCCACAGCCACTACTGA
        |||||||||||||||||
  79698 CCCACAGCCACTACTGA

END