Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: U25774.1
Subject Sequence ID: ENSG00000012048
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/U25774.1, 132 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000012048 (ENSG00000012048), 81091 bp

>gi|808073|gb|U25774.1|U25774 HSU25774 normal female breast tissue Homo sapiens cDNA clone 694:11, mRNA sequence
>ENSG00000012048

(complement)

1-132  (80960-81090)   97%

      0     .    :    .    :    .    :    .    :    .    :
      1 GTTTATAGCTGTTGGAAGGACTAGGTCTTCCCTAGCCCCCCCAGTGTGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80960 GTTTATAGCTGTTGGAAGGACTAGGTCTTCCCTAGCCCCCCCAGTGTGCA

     50     .    :    .    :    .    :    .    :    .    :
     51 AGGGCAGTGAAGACTTGATTGTACAAAATACGTTTTGTAAATGTTGTGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  81010 AGGGCAGTGAAGACTTGATTGTACAAAATACGTTTTGTAAATGTTGTGCT

    100     .    :    .    :    .    :
    101 GTTAACACTGCAAATAAACTTGGTAGCGATCT
        ||||||||||||||||||||||||||| | |-
  81060 GTTAACACTGCAAATAAACTTGGTAGCAAAC 

END