Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: T59742.1
Subject Sequence ID: ENSG00000141837
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/T59742.1, 334 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000141837 (ENSG00000141837), 298924 bp

>gi|661579|gb|T59742.1|T59742 yc13a02.r1 Stratagene lung (#937210) Homo sapiens cDNA clone IMAGE:80522 5' similar to SP:CCB1_RABIT P27883 BRAIN CALCIUM CHANNEL BI-1 ;, mRNA sequence
>ENSG00000141837

(complement)

1-334  (188917-189245)   97%

      0     .    :    .    :    .    :    .    :    .    :
      1 CCGAGCCAGCATTAAAAGTGCCAAGCTGGAGAACTCGACCTTTTTTCACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188917 CCGAGCCAGCATTAAAAGTGCCAAGCTGGAGAACTCGACCTTTTTTCACA

     50     .    :    .    :    .    :    .    :    .    :
     51 AAAAGGAGAGGAGGATGCGTTTCTACATCCGCCGCATGGTCAAAACTCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188967 AAAAGGAGAGGAGGATGCGTTTCTACATCCGCCGCATGGTCAAAACTCAG

    100     .    :    .    :    .    :    .    :    .    :
    101 GCCTTCTACTGGACTGTACTCAGTTTGGTAGCTCTCAACACGCTGTGTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 189017 GCCTTCTACTGGACTGTACTCAGTTTGGTAGCTCTCAACACGCTGTGTGT

    150     .    :    .    :    .    :    .    :    .    :
    151 TGCTATTGTTCACTACAACCAGCCCGAGTGGCTCTCCGACTTCCTTTGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 189067 TGCTATTGTTCACTACAACCAGCCCGAGTGGCTCTCCGACTTCCTTTGTG

    200     .    :    .    :    .    :    .    :    .    :
    201 AGTATCACCCAGCCCCACCCCTGCCAACTCCCTGATCCCTCCCTCACACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 189117 AGTATCACCCAGCCCCACCCCTGCCAACTCCCTGATCCCTCCCTCACACC

    250     .    :    .    :    .    :    .    :    .    :
    251 CTTTTTCCACTTNTCTTTCTCTGGTAGTATGTGTATCTTCTTTGGGTCCT
        |||||||||||| ||||||||||||||||||||||||||||||||-||||
 189167 CTTTTTCCACTTCTCTTTCTCTGGTAGTATGTGTATCTTCTTTGG TCCT

    300     .    :    .    :    .    :
    301 CATTGGAATNTGGCCCTTTTCCTTTAGGCCATTT
        |||||-||| |-||||-||||||||||-||||||
 189216 CATTG AATCT GCCC TTTCCTTTAG CCATTT

END