Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: R88046.1
Subject Sequence ID: ENSG00000141837
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/R88046.1, 294 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000141837 (ENSG00000141837), 298924 bp

>gi|946859|gb|R88046.1|R88046 ym87h02.r1 Soares adult brain N2b4HB55Y Homo sapiens cDNA clone IMAGE:165939 5' similar to SP:CCB1_RABIT P27883 BRAIN CALCIUM CHANNEL BI-1 ;, mRNA sequence
>ENSG00000141837

(complement)

1-99  (281460-281558)   98% ->
100-207  (291617-291724)   98% ->
208-294  (291892-291977)   96%

      0     .    :    .    :    .    :    .    :    .    :
      1 TGCGGATGGACCTGCCCNTCGCAGATGACAACACCGTCCACTTCAATTCC
        ||||||||||||||||| ||||||||||||||||||||||||||||||||
 281460 TGCGGATGGACCTGCCCGTCGCAGATGACAACACCGTCCACTTCAATTCC

     50     .    :    .    :    .    :    .    :    .    :
     51 ACCCTCATGGCTCTGATCCGCACAGCCCTGGACATCAAGATTGCCAAGG 
        |||||||||||||||||||||||||||||||||||||||||||||||||>
 281510 ACCCTCATGGCTCTGATCCGCACAGCCCTGGACATCAAGATTGCCAAGGG

    100     .    :    .    :    .    :    .    :    .    :
    100         TAGGAGCCGACAAACAGCAGATGGACGCTGAGCTGCGGAAGG
        >>...>>> |||||||||||||||||||||||||||||||||||||||||
 281560 TA...CAGGAGGAGCCGACAAACAGCAGATGGACGCTGAGCTGCGGAAGG

    150     .    :    .    :    .    :    .    :    .    :
    142 AGATGATGGCGATTTGGCCCAATCTGTCCCAGAAGACGCTAGACCTGCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 291659 AGATGATGGCGATTTGGCCCAATCTGTCCCAGAAGACGCTAGACCTGCTG

    200     .    :    .    :    .    :    .    :    .    :
    192 GTCACACCTNACAAGT         CCACGGACCTNACCNTGGGGGAAGA
        ||||||||| ||||||>>>...>>>|||||||||| ||| |||||-||||
 291709 GTCACACCTCACAAGTGTA...CAGCCACGGACCTCACCGTGGGG AAGA

    250     .    :    .    :    .    :    .    :    .    :
    233 TCTACGCAGCCATGATGATCATGGAGTACTACCGGCAGAGCAAGGCCAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 291916 TCTACGCAGCCATGATGATCATGGAGTACTACCGGCAGAGCAAGGCCAAG

    300     .    :
    283 AAGCTGCAGGCC
        ||||||||||||
 291966 AAGCTGCAGGCC

END