Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: NM_023035.1
Subject Sequence ID: ENSG00000141837
Subject Sequence type: 2


seq1 = /RAID/mart2/Splice/public_html/fasta/rna.fa/NM_02/NM_023035.1, 7812 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000141837 (ENSG00000141837), 298924 bp

>gi|13386497|ref|NM_023035.1| Homo sapiens calcium channel, voltage-dependent, P/Q type, alpha 1A subunit (CACNA1A), transcript variant 2, mRNA
>ENSG00000141837

(complement)

283-575  (1-293)   100% ->
576-681  (51013-51118)   100% ->
682-821  (53210-53349)   100% ->
822-913  (134446-134537)   100% ->
914-1066  (140756-140908)   100% ->
1067-1260  (146426-146619)   100% ->
1261-1364  (170316-170419)   100% ->
1365-1480  (171732-171847)   99% ->
1481-1537  (173300-173356)   100% ->
1538-1630  (175889-175981)   100% ->
1631-1840  (188904-189113)   100% ->
1841-1953  (193444-193556)   100% ->
1954-2066  (197697-197809)   100% ->
2067-2198  (197974-198105)   100% ->
2199-2271  (198371-198443)   100% ->
2272-2389  (202341-202458)   100% ->
2390-2457  (202612-202679)   100% ->
2458-2564  (205569-205675)   100% ->
2565-3374  (206872-207681)   100% ->
3375-3838  (219259-219722)   100% ->
3839-3977  (221019-221157)   100% ->
3978-4107  (222829-222958)   100% ->
4108-4167  (229097-229156)   100% ->
4168-4274  (230269-230375)   100% ->
4275-4374  (243392-243491)   100% ->
4375-4535  (244615-244775)   100% ->
4536-4673  (246524-246661)   100% ->
4674-4875  (248674-248875)   100% ->
4876-5040  (250966-251130)   100% ->
5041-5151  (253124-253234)   100% ->
5152-5235  (260960-261043)   100% ->
5236-5352  (270495-270611)   100% ->
5353-5418  (270951-271016)   100% ->
5419-5534  (271189-271304)   100% ->
5535-5685  (274365-274515)   100% ->
5686-5813  (276016-276143)   100% ->
5814-5910  (277430-277526)   100% ->
5911-6016  (281453-281558)   100% ->
6017-6124  (291617-291724)   100% ->
6125-6225  (291892-291992)   100% ->
6226-6335  (293485-293594)   100% ->
6336-6474  (293703-293841)   100% ->
6475-6588  (294009-294122)   100% ->
6589-6624  (295573-295608)   100% ->
6625-6811  (296727-296913)   100% ->
6812-7065  (297216-297469)   100% ->
7066-7812  (298172-298924)   99%

      0     .    :    .    :    .    :    .    :    .    :
    283 ATGGCCCGCTTCGGAGACGAGATGCCGGCCCGCTACGGGGGAGGAGGCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      1 ATGGCCCGCTTCGGAGACGAGATGCCGGCCCGCTACGGGGGAGGAGGCTC

     50     .    :    .    :    .    :    .    :    .    :
    333 CGGGGCAGCCGCCGGGGTGGTCGTGGGCAGCGGAGGCGGGCGAGGAGCCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     51 CGGGGCAGCCGCCGGGGTGGTCGTGGGCAGCGGAGGCGGGCGAGGAGCCG

    100     .    :    .    :    .    :    .    :    .    :
    383 GGGGCAGCCGGCAGGGCGGGCAGCCCGGGGCGCAAAGGATGTACAAGCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    101 GGGGCAGCCGGCAGGGCGGGCAGCCCGGGGCGCAAAGGATGTACAAGCAG

    150     .    :    .    :    .    :    .    :    .    :
    433 TCAATGGCGCAGAGAGCGCGGACCATGGCACTCTACAACCCCATCCCCGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    151 TCAATGGCGCAGAGAGCGCGGACCATGGCACTCTACAACCCCATCCCCGT

    200     .    :    .    :    .    :    .    :    .    :
    483 CCGACAGAACTGCCTCACGGTTAACCGGTCTCTCTTCCTCTTCAGCGAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    201 CCGACAGAACTGCCTCACGGTTAACCGGTCTCTCTTCCTCTTCAGCGAAG

    250     .    :    .    :    .    :    .    :    .    :
    533 ACAACGTGGTGAGAAAATACGCCAAAAAGATCACCGAATGGCC       
        |||||||||||||||||||||||||||||||||||||||||||>>>...>
    251 ACAACGTGGTGAGAAAATACGCCAAAAAGATCACCGAATGGCCATA...T

    300     .    :    .    :    .    :    .    :    .    :
    576   TCCCTTTGAATATATGATTTTAGCCACCATCATAGCGAATTGCATCGT
        >>||||||||||||||||||||||||||||||||||||||||||||||||
  51011 ACTCCCTTTGAATATATGATTTTAGCCACCATCATAGCGAATTGCATCGT

    350     .    :    .    :    .    :    .    :    .    :
    624 CCTCGCACTGGAGCAGCATCTGCCTGATGATGACAAGACCCCGATGTCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  51061 CCTCGCACTGGAGCAGCATCTGCCTGATGATGACAAGACCCCGATGTCTG

    400     .    :    .    :    .    :    .    :    .    :
    674 AACGGCTG         GATGACACAGAACCATACTTCATTGGAATTTTT
        ||||||||>>>...>>>|||||||||||||||||||||||||||||||||
  51111 AACGGCTGGTG...CAGGATGACACAGAACCATACTTCATTGGAATTTTT

    450     .    :    .    :    .    :    .    :    .    :
    715 TGTTTCGAGGCTGGAATTAAAATCATTGCCCTTGGGTTTGCCTTCCACAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  53243 TGTTTCGAGGCTGGAATTAAAATCATTGCCCTTGGGTTTGCCTTCCACAA

    500     .    :    .    :    .    :    .    :    .    :
    765 AGGCTCCTACTTGAGGAATGGCTGGAATGTCATGGACTTTGTGGTGGTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  53293 AGGCTCCTACTTGAGGAATGGCTGGAATGTCATGGACTTTGTGGTGGTGC

    550     .    :    .    :    .    :    .    :    .    :
    815 TAACGGG         CATCTTGGCGACAGTTGGGACGGAGTTTGACCTA
        |||||||>>>...>>>||||||||||||||||||||||||||||||||||
  53343 TAACGGGGTA...CAGCATCTTGGCGACAGTTGGGACGGAGTTTGACCTA

    600     .    :    .    :    .    :    .    :    .    :
    856 CGGACGCTGAGGGCAGTTCGAGTGCTGCGGCCGCTCAAGCTGGTGTCTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 134480 CGGACGCTGAGGGCAGTTCGAGTGCTGCGGCCGCTCAAGCTGGTGTCTGG

    650     .    :    .    :    .    :    .    :    .    :
    906 AATCCCAA         GTTTACAAGTCGTCCTGAAGTCGATCATGAAGG
        ||||||||>>>...>>>|||||||||||||||||||||||||||||||||
 134530 AATCCCAAGTG...CAGGTTTACAAGTCGTCCTGAAGTCGATCATGAAGG

    700     .    :    .    :    .    :    .    :    .    :
    947 CGATGATCCCTTTGCTGCAGATCGGCCTCCTCCTATTTTTTGCAATCCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 140789 CGATGATCCCTTTGCTGCAGATCGGCCTCCTCCTATTTTTTGCAATCCTT

    750     .    :    .    :    .    :    .    :    .    :
    997 ATTTTTGCAATCATAGGGTTAGAATTTTATATGGGAAAATTTCATACCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 140839 ATTTTTGCAATCATAGGGTTAGAATTTTATATGGGAAAATTTCATACCAC

    800     .    :    .    :    .    :    .    :    .    :
   1047 CTGCTTTGAAGAGGGGACAG         ATGACATTCAGGGTGAGTCTC
        ||||||||||||||||||||>>>...>>>|||||||||||||||||||||
 140889 CTGCTTTGAAGAGGGGACAGGTA...TAGATGACATTCAGGGTGAGTCTC

    850     .    :    .    :    .    :    .    :    .    :
   1088 CGGCTCCATGTGGGACAGAAGAGCCCGCCCGCACCTGCCCCAATGGGACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 146447 CGGCTCCATGTGGGACAGAAGAGCCCGCCCGCACCTGCCCCAATGGGACC

    900     .    :    .    :    .    :    .    :    .    :
   1138 AAATGTCAGCCCTACTGGGAAGGGCCCAACAACGGGATCACTCAGTTCGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 146497 AAATGTCAGCCCTACTGGGAAGGGCCCAACAACGGGATCACTCAGTTCGA

    950     .    :    .    :    .    :    .    :    .    :
   1188 CAACATCCTGTTTGCAGTGCTGACTGTTTTCCAGTGCATAACCATGGAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 146547 CAACATCCTGTTTGCAGTGCTGACTGTTTTCCAGTGCATAACCATGGAAG

   1000     .    :    .    :    .    :    .    :    .    :
   1238 GGTGGACTGATCTCCTCTACAAT         AGCAACGATGCCTCAGGG
        |||||||||||||||||||||||>>>...>>>||||||||||||||||||
 146597 GGTGGACTGATCTCCTCTACAATGTA...CAGAGCAACGATGCCTCAGGG

   1050     .    :    .    :    .    :    .    :    .    :
   1279 AACACTTGGAACTGGTTGTACTTCATCCCCCTCATCATCATCGGCTCCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 170334 AACACTTGGAACTGGTTGTACTTCATCCCCCTCATCATCATCGGCTCCTT

   1100     .    :    .    :    .    :    .    :    .    :
   1329 TTTTATGCTGAACCTTGTGCTGGGTGTGCTGTCAGG         GGAGT
        ||||||||||||||||||||||||||||||||||||>>>...>>>|||||
 170384 TTTTATGCTGAACCTTGTGCTGGGTGTGCTGTCAGGGTA...CAGGGAGT

   1150     .    :    .    :    .    :    .    :    .    :
   1370 TTGCCAAAGAAAGGGAACGGGTGGAGAACCGGCGGGCTTTTCTGAAGCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 171737 TTGCCAAAGAAAGGGAACGGGTGGAGAACCGGCGGGCTTTTCTGAAGCTG

   1200     .    :    .    :    .    :    .    :    .    :
   1420 AGGCGGCAACAACAGATTGAACGTGAGCTCAATGGGTACATGGAATGGAT
        |||||||||||||||||||||||||||||||||||||||||||| |||||
 171787 AGGCGGCAACAACAGATTGAACGTGAGCTCAATGGGTACATGGAGTGGAT

   1250     .    :    .    :    .    :    .    :    .    :
   1470 CTCAAAAGCAG         AAGAGGTGATCCTCGCCGAGGATGAAACTG
        |||||||||||>>>...>>>||||||||||||||||||||||||||||||
 171837 CTCAAAAGCAGGTG...CAGAAGAGGTGATCCTCGCCGAGGATGAAACTG

   1300     .    :    .    :    .    :    .    :    .    :
   1511 ACGGGGAGCAGAGGCATCCCTTTGATG         GAGCTCTGCGGAGA
        |||||||||||||||||||||||||||>>>...>>>||||||||||||||
 173330 ACGGGGAGCAGAGGCATCCCTTTGATGGTA...TTGGAGCTCTGCGGAGA

   1350     .    :    .    :    .    :    .    :    .    :
   1552 ACCACCATAAAGAAAAGCAAGACAGATTTGCTCAACCCCGAAGAGGCTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 175903 ACCACCATAAAGAAAAGCAAGACAGATTTGCTCAACCCCGAAGAGGCTGA

   1400     .    :    .    :    .    :    .    :    .    :
   1602 GGATCAGCTGGCTGATATAGCCTCTGTGG         GTTCTCCCTTCG
        |||||||||||||||||||||||||||||>>>...>>>||||||||||||
 175953 GGATCAGCTGGCTGATATAGCCTCTGTGGGTG...CAGGTTCTCCCTTCG

   1450     .    :    .    :    .    :    .    :    .    :
   1643 CCCGAGCCAGCATTAAAAGTGCCAAGCTGGAGAACTCGACCTTTTTTCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188916 CCCGAGCCAGCATTAAAAGTGCCAAGCTGGAGAACTCGACCTTTTTTCAC

   1500     .    :    .    :    .    :    .    :    .    :
   1693 AAAAAGGAGAGGAGGATGCGTTTCTACATCCGCCGCATGGTCAAAACTCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188966 AAAAAGGAGAGGAGGATGCGTTTCTACATCCGCCGCATGGTCAAAACTCA

   1550     .    :    .    :    .    :    .    :    .    :
   1743 GGCCTTCTACTGGACTGTACTCAGTTTGGTAGCTCTCAACACGCTGTGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 189016 GGCCTTCTACTGGACTGTACTCAGTTTGGTAGCTCTCAACACGCTGTGTG

   1600     .    :    .    :    .    :    .    :    .    :
   1793 TTGCTATTGTTCACTACAACCAGCCCGAGTGGCTCTCCGACTTCCTTT  
        ||||||||||||||||||||||||||||||||||||||||||||||||>>
 189066 TTGCTATTGTTCACTACAACCAGCCCGAGTGGCTCTCCGACTTCCTTTGT

   1650     .    :    .    :    .    :    .    :    .    :
   1841        ACTATGCAGAATTCATTTTCTTAGGACTCTTTATGTCCGAAAT
        >...>>>|||||||||||||||||||||||||||||||||||||||||||
 189116 G...TAGACTATGCAGAATTCATTTTCTTAGGACTCTTTATGTCCGAAAT

   1700     .    :    .    :    .    :    .    :    .    :
   1884 GTTTATAAAAATGTACGGGCTTGGGACGCGGCCTTACTTCCACTCTTCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 193487 GTTTATAAAAATGTACGGGCTTGGGACGCGGCCTTACTTCCACTCTTCCT

   1750     .    :    .    :    .    :    .    :    .    :
   1934 TCAACTGCTTTGACTGTGGG         GTTATCATTGGGAGCATCTTC
        ||||||||||||||||||||>>>...>>>|||||||||||||||||||||
 193537 TCAACTGCTTTGACTGTGGGGTA...TAGGTTATCATTGGGAGCATCTTC

   1800     .    :    .    :    .    :    .    :    .    :
   1975 GAGGTCATCTGGGCTGTCATAAAACCTGGCACATCCTTTGGAATCAGCGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 197718 GAGGTCATCTGGGCTGTCATAAAACCTGGCACATCCTTTGGAATCAGCGT

   1850     .    :    .    :    .    :    .    :    .    :
   2025 GTTACGAGCCCTCAGGTTATTGCGTATTTTCAAAGTCACAAA        
        ||||||||||||||||||||||||||||||||||||||||||>>>...>>
 197768 GTTACGAGCCCTCAGGTTATTGCGTATTTTCAAAGTCACAAAGTA...CA

   1900     .    :    .    :    .    :    .    :    .    :
   2067  GTACTGGGCATCTCTCAGAAACCTGGTCGTCTCTCTCCTCAACTCCATG
        >|||||||||||||||||||||||||||||||||||||||||||||||||
 197973 GGTACTGGGCATCTCTCAGAAACCTGGTCGTCTCTCTCCTCAACTCCATG

   1950     .    :    .    :    .    :    .    :    .    :
   2116 AAGTCCATCATCAGCCTGTTGTTTCTCCTTTTCCTGTTCATTGTCGTCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 198023 AAGTCCATCATCAGCCTGTTGTTTCTCCTTTTCCTGTTCATTGTCGTCTT

   2000     .    :    .    :    .    :    .    :    .    :
   2166 CGCCCTTTTGGGAATGCAACTCTTCGGCGGCCA         GTTTAATT
        |||||||||||||||||||||||||||||||||>>>...>>>||||||||
 198073 CGCCCTTTTGGGAATGCAACTCTTCGGCGGCCAGTA...CAGGTTTAATT

   2050     .    :    .    :    .    :    .    :    .    :
   2207 TCGATGAAGGGACTCCTCCCACCAACTTCGATACTTTTCCAGCAGCAATA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 198379 TCGATGAAGGGACTCCTCCCACCAACTTCGATACTTTTCCAGCAGCAATA

   2100     .    :    .    :    .    :    .    :    .    :
   2257 ATGACGGTGTTTCAG         ATCCTGACGGGCGAAGACTGGAACGA
        |||||||||||||||>>>...>>>||||||||||||||||||||||||||
 198429 ATGACGGTGTTTCAGGTA...CAGATCCTGACGGGCGAAGACTGGAACGA

   2150     .    :    .    :    .    :    .    :    .    :
   2298 GGTCATGTACGACGGGATCAAGTCTCAGGGGGGCGTGCAGGGCGGCATGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 202367 GGTCATGTACGACGGGATCAAGTCTCAGGGGGGCGTGCAGGGCGGCATGG

   2200     .    :    .    :    .    :    .    :    .    :
   2348 TGTTCTCCATCTATTTCATTGTACTGACGCTCTTTGGGAACT        
        ||||||||||||||||||||||||||||||||||||||||||>>>...>>
 202417 TGTTCTCCATCTATTTCATTGTACTGACGCTCTTTGGGAACTGTA...CA

   2250     .    :    .    :    .    :    .    :    .    :
   2390  ACACCCTCCTGAATGTGTTCTTGGCCATCGCTGTGGACAATCTGGCCAA
        >|||||||||||||||||||||||||||||||||||||||||||||||||
 202611 GACACCCTCCTGAATGTGTTCTTGGCCATCGCTGTGGACAATCTGGCCAA

   2300     .    :    .    :    .    :    .    :    .    :
   2439 CGCCCAGGAGCTCACCAAG         GACGAGCAAGAGGAAGAAGAAG
        |||||||||||||||||||>>>...>>>||||||||||||||||||||||
 202661 CGCCCAGGAGCTCACCAAGGTG...TAGGACGAGCAAGAGGAAGAAGAAG

   2350     .    :    .    :    .    :    .    :    .    :
   2480 CAGCGAACCAGAAACTTGCCCTACAGAAAGCCAAGGAGGTGGCAGAAGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 205591 CAGCGAACCAGAAACTTGCCCTACAGAAAGCCAAGGAGGTGGCAGAAGTG

   2400     .    :    .    :    .    :    .    :    .    :
   2530 AGTCCTCTGTCCGCGGCCAACATGTCTATAGCTGT         GAAAGA
        |||||||||||||||||||||||||||||||||||>>>...>>>||||||
 205641 AGTCCTCTGTCCGCGGCCAACATGTCTATAGCTGTGTA...CAGGAAAGA

   2450     .    :    .    :    .    :    .    :    .    :
   2571 GCAACAGAAGAATCAAAAGCCAGCCAAGTCCGTGTGGGAGCAGCGGACCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 206878 GCAACAGAAGAATCAAAAGCCAGCCAAGTCCGTGTGGGAGCAGCGGACCA

   2500     .    :    .    :    .    :    .    :    .    :
   2621 GTGAGATGCGAAAGCAGAACTTGCTGGCCAGCCGGGAGGCCCTGTATAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 206928 GTGAGATGCGAAAGCAGAACTTGCTGGCCAGCCGGGAGGCCCTGTATAAC

   2550     .    :    .    :    .    :    .    :    .    :
   2671 GAAATGGACCCGGACGAGCGCTGGAAGGCTGCCTACACGCGGCACCTGCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 206978 GAAATGGACCCGGACGAGCGCTGGAAGGCTGCCTACACGCGGCACCTGCG

   2600     .    :    .    :    .    :    .    :    .    :
   2721 GCCAGACATGAAGACGCACTTGGACCGGCCGCTGGTGGTGGACCCGCAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207028 GCCAGACATGAAGACGCACTTGGACCGGCCGCTGGTGGTGGACCCGCAGG

   2650     .    :    .    :    .    :    .    :    .    :
   2771 AGAACCGCAACAACAACACCAACAAGAGCCGGGCGGCCGAGCCCACCGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207078 AGAACCGCAACAACAACACCAACAAGAGCCGGGCGGCCGAGCCCACCGTG

   2700     .    :    .    :    .    :    .    :    .    :
   2821 GACCAGCGCCTCGGCCAGCAGCGCGCCGAGGACTTCCTCAGGAAACAGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207128 GACCAGCGCCTCGGCCAGCAGCGCGCCGAGGACTTCCTCAGGAAACAGGC

   2750     .    :    .    :    .    :    .    :    .    :
   2871 CCGCTACCACGATCGGGCCCGGGACCCCAGCGGCTCGGCGGGCCTGGACG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207178 CCGCTACCACGATCGGGCCCGGGACCCCAGCGGCTCGGCGGGCCTGGACG

   2800     .    :    .    :    .    :    .    :    .    :
   2921 CACGGAGGCCCTGGGCGGGAAGCCAGGAGGCCGAGCTGAGCCGGGAGGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207228 CACGGAGGCCCTGGGCGGGAAGCCAGGAGGCCGAGCTGAGCCGGGAGGGA

   2850     .    :    .    :    .    :    .    :    .    :
   2971 CCCTACGGCCGCGAGTCGGACCACCACGCCCGGGAGGGCAGCCTGGAGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207278 CCCTACGGCCGCGAGTCGGACCACCACGCCCGGGAGGGCAGCCTGGAGCA

   2900     .    :    .    :    .    :    .    :    .    :
   3021 ACCCGGGTTCTGGGAGGGCGAGGCCGAGCGAGGCAAGGCCGGGGACCCCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207328 ACCCGGGTTCTGGGAGGGCGAGGCCGAGCGAGGCAAGGCCGGGGACCCCC

   2950     .    :    .    :    .    :    .    :    .    :
   3071 ACCGGAGGCACGTGCACCGGCAGGGGGGCAGCAGGGAGAGCCGCAGCGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207378 ACCGGAGGCACGTGCACCGGCAGGGGGGCAGCAGGGAGAGCCGCAGCGGG

   3000     .    :    .    :    .    :    .    :    .    :
   3121 TCCCCGCGCACGGGCGCGGACGGGGAGCATCGACGTCATCGCGCGCACCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207428 TCCCCGCGCACGGGCGCGGACGGGGAGCATCGACGTCATCGCGCGCACCG

   3050     .    :    .    :    .    :    .    :    .    :
   3171 CAGGCCCGGGGAGGAGGGTCCGGAGGACAAGGCGGAGCGGAGGGCGCGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207478 CAGGCCCGGGGAGGAGGGTCCGGAGGACAAGGCGGAGCGGAGGGCGCGGC

   3100     .    :    .    :    .    :    .    :    .    :
   3221 ACCGCGAGGGCAGCCGGCCGGCCCGGGGCGGCGAGGGCGAGGGCGAGGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207528 ACCGCGAGGGCAGCCGGCCGGCCCGGGGCGGCGAGGGCGAGGGCGAGGGC

   3150     .    :    .    :    .    :    .    :    .    :
   3271 CCCGACGGGGGCGAGCGCAGGAGAAGGCACCGGCATGGCGCTCCAGCCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207578 CCCGACGGGGGCGAGCGCAGGAGAAGGCACCGGCATGGCGCTCCAGCCAC

   3200     .    :    .    :    .    :    .    :    .    :
   3321 GTACGAGGGGGACGCGCGGAGGGAGGACAAGGAGCGGAGGCATCGGAGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207628 GTACGAGGGGGACGCGCGGAGGGAGGACAAGGAGCGGAGGCATCGGAGGA

   3250     .    :    .    :    .    :    .    :    .    :
   3371 GGAA         AGAGAACCAGGGCTCCGGGGTCCCTGTGTCGGGCCCC
        ||||>>>...>>>|||||||||||||||||||||||||||||||||||||
 207678 GGAAGTA...CAGAGAGAACCAGGGCTCCGGGGTCCCTGTGTCGGGCCCC

   3300     .    :    .    :    .    :    .    :    .    :
   3412 AACCTGTCAACCACCCGGCCAATCCAGCAGGACCTGGGCCGCCAAGACCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219296 AACCTGTCAACCACCCGGCCAATCCAGCAGGACCTGGGCCGCCAAGACCC

   3350     .    :    .    :    .    :    .    :    .    :
   3462 ACCCCTGGCAGAGGATATTGACAACATGAAGAACAACAAGCTGGCCACCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219346 ACCCCTGGCAGAGGATATTGACAACATGAAGAACAACAAGCTGGCCACCG

   3400     .    :    .    :    .    :    .    :    .    :
   3512 CGGAGTCGGCCGCTCCCCACGGCAGCCTTGGCCACGCCGGCCTGCCCCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219396 CGGAGTCGGCCGCTCCCCACGGCAGCCTTGGCCACGCCGGCCTGCCCCAG

   3450     .    :    .    :    .    :    .    :    .    :
   3562 AGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCATGCTGGCCAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219446 AGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCATGCTGGCCAT

   3500     .    :    .    :    .    :    .    :    .    :
   3612 CCCTGCCATGGCCACCAACCCCCAGAACGCCGCCAGCCGCCGGACGCCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219496 CCCTGCCATGGCCACCAACCCCCAGAACGCCGCCAGCCGCCGGACGCCCA

   3550     .    :    .    :    .    :    .    :    .    :
   3662 ACAACCCGGGGAACCCATCCAATCCCGGCCCCCCCAAGACCCCCGAGAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219546 ACAACCCGGGGAACCCATCCAATCCCGGCCCCCCCAAGACCCCCGAGAAT

   3600     .    :    .    :    .    :    .    :    .    :
   3712 AGCCTTATCGTCACCAACCCCAGCGGCACCCAGACCAATTCAGCTAAGAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219596 AGCCTTATCGTCACCAACCCCAGCGGCACCCAGACCAATTCAGCTAAGAC

   3650     .    :    .    :    .    :    .    :    .    :
   3762 TGCCAGGAAACCCGACCACACCACAGTGGACATCCCCCCAGCCTGCCCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219646 TGCCAGGAAACCCGACCACACCACAGTGGACATCCCCCCAGCCTGCCCAC

   3700     .    :    .    :    .    :    .    :    .    :
   3812 CCCCCCTCAACCACACCGTCGTACAAG         TGAACAAAAACGCC
        |||||||||||||||||||||||||||>>>...>>>||||||||||||||
 219696 CCCCCCTCAACCACACCGTCGTACAAGGTG...CAGTGAACAAAAACGCC

   3750     .    :    .    :    .    :    .    :    .    :
   3853 AACCCAGACCCACTGCCAAAAAAAGAGGAAGAGAAGAAGGAGGAGGAGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 221033 AACCCAGACCCACTGCCAAAAAAAGAGGAAGAGAAGAAGGAGGAGGAGGA

   3800     .    :    .    :    .    :    .    :    .    :
   3903 AGACGACCGTGGGGAAGACGGCCCTAAGCCAATGCCTCCCTATAGCTCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 221083 AGACGACCGTGGGGAAGACGGCCCTAAGCCAATGCCTCCCTATAGCTCCA

   3850     .    :    .    :    .    :    .    :    .    :
   3953 TGTTCATCCTGTCCACGACCAACCC         CCTTCGCCGCCTGTGC
        |||||||||||||||||||||||||>>>...>>>||||||||||||||||
 221133 TGTTCATCCTGTCCACGACCAACCCGTG...CAGCCTTCGCCGCCTGTGC

   3900     .    :    .    :    .    :    .    :    .    :
   3994 CATTACATCCTGAACCTGCGCTACTTTGAGATGTGCATCCTCATGGTCAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 222845 CATTACATCCTGAACCTGCGCTACTTTGAGATGTGCATCCTCATGGTCAT

   3950     .    :    .    :    .    :    .    :    .    :
   4044 TGCCATGAGCAGCATCGCCCTGGCCGCCGAGGACCCTGTGCAGCCCAACG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 222895 TGCCATGAGCAGCATCGCCCTGGCCGCCGAGGACCCTGTGCAGCCCAACG

   4000     .    :    .    :    .    :    .    :    .    :
   4094 CACCTCGGAACAAC         GTGCTGCGATACTTTGACTACGTTTTT
        ||||||||||||||>>>...>>>|||||||||||||||||||||||||||
 222945 CACCTCGGAACAACGTG...CAGGTGCTGCGATACTTTGACTACGTTTTT

   4050     .    :    .    :    .    :    .    :    .    :
   4135 ACAGGCGTCTTTACCTTTGAGATGGTGATCAAG         ATGATTGA
        |||||||||||||||||||||||||||||||||>>>...>>>||||||||
 229124 ACAGGCGTCTTTACCTTTGAGATGGTGATCAAGGTG...CAGATGATTGA

   4100     .    :    .    :    .    :    .    :    .    :
   4176 CCTGGGGCTCGTCCTGCATCAGGGTGCCTACTTCCGTGACCTCTGGAATA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 230277 CCTGGGGCTCGTCCTGCATCAGGGTGCCTACTTCCGTGACCTCTGGAATA

   4150     .    :    .    :    .    :    .    :    .    :
   4226 TTCTCGACTTCATAGTGGTCAGTGGGGCCCTGGTAGCCTTTGCCTTCAC 
        |||||||||||||||||||||||||||||||||||||||||||||||||>
 230327 TTCTCGACTTCATAGTGGTCAGTGGGGCCCTGGTAGCCTTTGCCTTCACG

   4200     .    :    .    :    .    :    .    :    .    :
   4275         TGGCAATAGCAAAGGAAAAGACATCAACACGATTAAATCCCT
        >>...>>>||||||||||||||||||||||||||||||||||||||||||
 230377 TA...CAGTGGCAATAGCAAAGGAAAAGACATCAACACGATTAAATCCCT

   4250     .    :    .    :    .    :    .    :    .    :
   4317 CCGAGTCCTCCGGGTGCTACGACCTCTTAAAACCATCAAGCGGCTGCCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 243434 CCGAGTCCTCCGGGTGCTACGACCTCTTAAAACCATCAAGCGGCTGCCAA

   4300     .    :    .    :    .    :    .    :    .    :
   4367 AGCTCAAG         GCTGTGTTTGACTGTGTGGTGAACTCACTTAAA
        ||||||||>>>...>>>|||||||||||||||||||||||||||||||||
 243484 AGCTCAAGGTG...CAGGCTGTGTTTGACTGTGTGGTGAACTCACTTAAA

   4350     .    :    .    :    .    :    .    :    .    :
   4408 AACGTCTTCAACATCCTCATCGTCTACATGCTATTCATGTTCATCTTCGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 244648 AACGTCTTCAACATCCTCATCGTCTACATGCTATTCATGTTCATCTTCGC

   4400     .    :    .    :    .    :    .    :    .    :
   4458 CGTGGTGGCTGTGCAGCTCTTCAAGGGGAAATTCTTCCACTGCACTGACG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 244698 CGTGGTGGCTGTGCAGCTCTTCAAGGGGAAATTCTTCCACTGCACTGACG

   4450     .    :    .    :    .    :    .    :    .    :
   4508 AGTCCAAAGAGTTTGAGAAAGATTGTCG         AGGCAAATACCTC
        ||||||||||||||||||||||||||||>>>...>>>|||||||||||||
 244748 AGTCCAAAGAGTTTGAGAAAGATTGTCGGTG...CAGAGGCAAATACCTC

   4500     .    :    .    :    .    :    .    :    .    :
   4549 CTCTACGAGAAGAATGAGGTGAAGGCGCGAGACCGGGAGTGGAAGAAGTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 246537 CTCTACGAGAAGAATGAGGTGAAGGCGCGAGACCGGGAGTGGAAGAAGTA

   4550     .    :    .    :    .    :    .    :    .    :
   4599 TGAATTCCATTACGACAATGTGCTGTGGGCTCTGCTGACCCTCTTCACCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 246587 TGAATTCCATTACGACAATGTGCTGTGGGCTCTGCTGACCCTCTTCACCG

   4600     .    :    .    :    .    :    .    :    .    :
   4649 TGTCCACGGGAGAAGGCTGGCCACA         GGTCCTCAAGCATTCG
        |||||||||||||||||||||||||>>>...>>>||||||||||||||||
 246637 TGTCCACGGGAGAAGGCTGGCCACAGTA...CAGGGTCCTCAAGCATTCG

   4650     .    :    .    :    .    :    .    :    .    :
   4690 GTGGACGCCACCTTTGAGAACCAGGGCCCCAGCCCCGGGTACCGCATGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 248690 GTGGACGCCACCTTTGAGAACCAGGGCCCCAGCCCCGGGTACCGCATGGA

   4700     .    :    .    :    .    :    .    :    .    :
   4740 GATGTCCATTTTCTACGTCGTCTACTTTGTGGTGTTCCCCTTCTTCTTTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 248740 GATGTCCATTTTCTACGTCGTCTACTTTGTGGTGTTCCCCTTCTTCTTTG

   4750     .    :    .    :    .    :    .    :    .    :
   4790 TCAATATCTTTGTGGCCTTGATCATCATCACCTTCCAGGAGCAAGGGGAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 248790 TCAATATCTTTGTGGCCTTGATCATCATCACCTTCCAGGAGCAAGGGGAC

   4800     .    :    .    :    .    :    .    :    .    :
   4840 AAGATGATGGAGGAATACAGCCTGGAGAAAAATGAG         AGGGC
        ||||||||||||||||||||||||||||||||||||>>>...>>>|||||
 248840 AAGATGATGGAGGAATACAGCCTGGAGAAAAATGAGGTG...CAGAGGGC

   4850     .    :    .    :    .    :    .    :    .    :
   4881 CTGCATTGATTTCGCCATCAGCGCCAAGCCGCTGACCCGACACATGCCGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 250971 CTGCATTGATTTCGCCATCAGCGCCAAGCCGCTGACCCGACACATGCCGC

   4900     .    :    .    :    .    :    .    :    .    :
   4931 AGAACAAGCAGAGCTTCCAGTACCGCATGTGGCAGTTCGTGGTGTCTCCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 251021 AGAACAAGCAGAGCTTCCAGTACCGCATGTGGCAGTTCGTGGTGTCTCCG

   4950     .    :    .    :    .    :    .    :    .    :
   4981 CCTTTCGAGTACACGATCATGGCCATGATCGCCCTCAACACCATCGTGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 251071 CCTTTCGAGTACACGATCATGGCCATGATCGCCCTCAACACCATCGTGCT

   5000     .    :    .    :    .    :    .    :    .    :
   5031 TATGATGAAG         TTCTATGGGGCTTCTGTTGCTTATGAAAATG
        ||||||||||>>>...>>>|||||||||||||||||||||||||||||||
 251121 TATGATGAAGGTA...TAGTTCTATGGGGCTTCTGTTGCTTATGAAAATG

   5050     .    :    .    :    .    :    .    :    .    :
   5072 CCCTGCGGGTGTTCAACATCGTCTTCACCTCCCTCTTCTCTCTGGAATGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 253155 CCCTGCGGGTGTTCAACATCGTCTTCACCTCCCTCTTCTCTCTGGAATGT

   5100     .    :    .    :    .    :    .    :    .    :
   5122 GTGCTGAAAGTCATGGCTTTTGGGATTCTG         AATTATTTCCG
        ||||||||||||||||||||||||||||||>>>...>>>|||||||||||
 253205 GTGCTGAAAGTCATGGCTTTTGGGATTCTGGTA...TAGAATTATTTCCG

   5150     .    :    .    :    .    :    .    :    .    :
   5163 CGATGCCTGGAACATCTTCGACTTTGTGACTGTTCTGGGCAGCATCACCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 260971 CGATGCCTGGAACATCTTCGACTTTGTGACTGTTCTGGGCAGCATCACCG

   5200     .    :    .    :    .    :    .    :    .    :
   5213 ATATCCTCGTGACTGAGTTTGGG         AATAACTTCATCAACCTG
        |||||||||||||||||||||||>>>...>>>||||||||||||||||||
 261021 ATATCCTCGTGACTGAGTTTGGGGTA...CAGAATAACTTCATCAACCTG

   5250     .    :    .    :    .    :    .    :    .    :
   5254 AGCTTTCTCCGCCTCTTCCGAGCTGCCCGGCTCATCAAACTTCTCCGTCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 270513 AGCTTTCTCCGCCTCTTCCGAGCTGCCCGGCTCATCAAACTTCTCCGTCA

   5300     .    :    .    :    .    :    .    :    .    :
   5304 GGGTTACACCATCCGCATTCTTCTCTGGACCTTTGTGCAGTCCTTCAAG 
        |||||||||||||||||||||||||||||||||||||||||||||||||>
 270563 GGGTTACACCATCCGCATTCTTCTCTGGACCTTTGTGCAGTCCTTCAAGG

   5350     .    :    .    :    .    :    .    :    .    :
   5353         GCCCTGCCTTATGTCTGTCTGCTGATCGCCATGCTCTTCTTC
        >>...>>>||||||||||||||||||||||||||||||||||||||||||
 270613 TG...CAGGCCCTGCCTTATGTCTGTCTGCTGATCGCCATGCTCTTCTTC

   5400     .    :    .    :    .    :    .    :    .    :
   5395 ATCTATGCCATCATTGGGATGCAG         GTGTTTGGTAACATTGG
        ||||||||||||||||||||||||>>>...>>>|||||||||||||||||
 270993 ATCTATGCCATCATTGGGATGCAGGTG...CAGGTGTTTGGTAACATTGG

   5450     .    :    .    :    .    :    .    :    .    :
   5436 CATCGACGTGGAGGACGAGGACAGTGATGAAGATGAGTTCCAAATCACTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 271206 CATCGACGTGGAGGACGAGGACAGTGATGAAGATGAGTTCCAAATCACTG

   5500     .    :    .    :    .    :    .    :    .    :
   5486 AGCACAATAACTTCCGGACCTTCTTCCAGGCCCTCATGCTTCTCTTCCG 
        |||||||||||||||||||||||||||||||||||||||||||||||||>
 271256 AGCACAATAACTTCCGGACCTTCTTCCAGGCCCTCATGCTTCTCTTCCGG

   5550     .    :    .    :    .    :    .    :    .    :
   5535         GAGTGCCACCGGGGAAGCTTGGCACAACATCATGCTTTCCTG
        >>...>>>||||||||||||||||||||||||||||||||||||||||||
 271306 TG...CAGGAGTGCCACCGGGGAAGCTTGGCACAACATCATGCTTTCCTG

   5600     .    :    .    :    .    :    .    :    .    :
   5577 CCTCAGCGGGAAACCGTGTGATAAGAACTCTGGCATCCTGACTCGAGAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 274407 CCTCAGCGGGAAACCGTGTGATAAGAACTCTGGCATCCTGACTCGAGAGT

   5650     .    :    .    :    .    :    .    :    .    :
   5627 GTGGCAATGAATTTGCTTATTTTTACTTTGTTTCCTTCATCTTCCTCTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 274457 GTGGCAATGAATTTGCTTATTTTTACTTTGTTTCCTTCATCTTCCTCTGC

   5700     .    :    .    :    .    :    .    :    .    :
   5677 TCGTTTCTG         ATGCTGAATCTCTTTGTCGCCGTCATCATGGA
        |||||||||>>>...>>>||||||||||||||||||||||||||||||||
 274507 TCGTTTCTGGTG...CAGATGCTGAATCTCTTTGTCGCCGTCATCATGGA

   5750     .    :    .    :    .    :    .    :    .    :
   5718 CAACTTTGAGTACCTCACCCGAGACTCCTCCATCCTGGGCCCCCACCACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 276048 CAACTTTGAGTACCTCACCCGAGACTCCTCCATCCTGGGCCCCCACCACC

   5800     .    :    .    :    .    :    .    :    .    :
   5768 TGGATGAGTACGTGCGTGTCTGGGCCGAGTATGACCCCGCAGCTTG    
        ||||||||||||||||||||||||||||||||||||||||||||||>>>.
 276098 TGGATGAGTACGTGCGTGTCTGGGCCGAGTATGACCCCGCAGCTTGGTA.

   5850     .    :    .    :    .    :    .    :    .    :
   5814      CGGTCGGATTCATTATAAGGATATGTACAGTTTATTACGAGTAAT
        ..>>>|||||||||||||||||||||||||||||||||||||||||||||
 276148 ..CAGCGGTCGGATTCATTATAAGGATATGTACAGTTTATTACGAGTAAT

   5900     .    :    .    :    .    :    .    :    .    :
   5859 ATCTCCCCCTCTCGGCTTAGGCAAGAAATGTCCTCATAGGGTTGCTTGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 277475 ATCTCCCCCTCTCGGCTTAGGCAAGAAATGTCCTCATAGGGTTGCTTGCA

   5950     .    :    .    :    .    :    .    :    .    :
   5909 AG         CGGCTTCTGCGGATGGACCTGCCCGTCGCAGATGACAAC
        ||>>>...>>>|||||||||||||||||||||||||||||||||||||||
 277525 AGGTT...TAGCGGCTTCTGCGGATGGACCTGCCCGTCGCAGATGACAAC

   6000     .    :    .    :    .    :    .    :    .    :
   5950 ACCGTCCACTTCAATTCCACCCTCATGGCTCTGATCCGCACAGCCCTGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 281492 ACCGTCCACTTCAATTCCACCCTCATGGCTCTGATCCGCACAGCCCTGGA

   6050     .    :    .    :    .    :    .    :    .    :
   6000 CATCAAGATTGCCAAGG         GAGGAGCCGACAAACAGCAGATGG
        |||||||||||||||||>>>...>>>||||||||||||||||||||||||
 281542 CATCAAGATTGCCAAGGGTA...CAGGAGGAGCCGACAAACAGCAGATGG

   6100     .    :    .    :    .    :    .    :    .    :
   6041 ACGCTGAGCTGCGGAAGGAGATGATGGCGATTTGGCCCAATCTGTCCCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 291641 ACGCTGAGCTGCGGAAGGAGATGATGGCGATTTGGCCCAATCTGTCCCAG

   6150     .    :    .    :    .    :    .    :    .    :
   6091 AAGACGCTAGACCTGCTGGTCACACCTCACAAGT         CCACGGA
        ||||||||||||||||||||||||||||||||||>>>...>>>|||||||
 291691 AAGACGCTAGACCTGCTGGTCACACCTCACAAGTGTA...CAGCCACGGA

   6200     .    :    .    :    .    :    .    :    .    :
   6132 CCTCACCGTGGGGAAGATCTACGCAGCCATGATGATCATGGAGTACTACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 291899 CCTCACCGTGGGGAAGATCTACGCAGCCATGATGATCATGGAGTACTACC

   6250     .    :    .    :    .    :    .    :    .    :
   6182 GGCAGAGCAAGGCCAAGAAGCTGCAGGCCATGCGCGAGGAGCAG      
        ||||||||||||||||||||||||||||||||||||||||||||>>>...
 291949 GGCAGAGCAAGGCCAAGAAGCTGCAGGCCATGCGCGAGGAGCAGGTG...

   6300     .    :    .    :    .    :    .    :    .    :
   6226    GACCGGACACCCCTCATGTTCCAGCGCATGGAGCCCCCGTCCCCAAC
        >>>|||||||||||||||||||||||||||||||||||||||||||||||
 293482 CAGGACCGGACACCCCTCATGTTCCAGCGCATGGAGCCCCCGTCCCCAAC

   6350     .    :    .    :    .    :    .    :    .    :
   6273 GCAGGAAGGGGGACCTGGCCAGAACGCCCTCCCCTCCACCCAGCTGGACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 293532 GCAGGAAGGGGGACCTGGCCAGAACGCCCTCCCCTCCACCCAGCTGGACC

   6400     .    :    .    :    .    :    .    :    .    :
   6323 CAGGAGGAGCCCT         GATGGCTCACGAAAGCGGCCTCAAGGAG
        |||||||||||||>>>...>>>||||||||||||||||||||||||||||
 293582 CAGGAGGAGCCCTGTG...CAGGATGGCTCACGAAAGCGGCCTCAAGGAG

   6450     .    :    .    :    .    :    .    :    .    :
   6364 AGCCCGTCCTGGGTGACCCAGCGTGCCCAGGAGATGTTCCAGAAGACGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 293731 AGCCCGTCCTGGGTGACCCAGCGTGCCCAGGAGATGTTCCAGAAGACGGG

   6500     .    :    .    :    .    :    .    :    .    :
   6414 CACATGGAGTCCGGAACAAGGCCCCCCTACCGACATGCCCAACAGCCAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 293781 CACATGGAGTCCGGAACAAGGCCCCCCTACCGACATGCCCAACAGCCAGC

   6550     .    :    .    :    .    :    .    :    .    :
   6464 CTAACTCTCAG         TCCGTGGAGATGCGAGAGATGGGCAGAGAT
        |||||||||||>>>...>>>||||||||||||||||||||||||||||||
 293831 CTAACTCTCAGGTG...CAGTCCGTGGAGATGCGAGAGATGGGCAGAGAT

   6600     .    :    .    :    .    :    .    :    .    :
   6505 GGCTACTCCGACAGCGAGCACTACCTCCCCATGGAAGGCCAGGGCCGGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 294039 GGCTACTCCGACAGCGAGCACTACCTCCCCATGGAAGGCCAGGGCCGGGC

   6650     .    :    .    :    .    :    .    :    .    :
   6555 TGCCTCCATGCCCCGCCTCCCTGCAGAGAACCAG         AGGAGAA
        ||||||||||||||||||||||||||||||||||>>>...>>>|||||||
 294089 TGCCTCCATGCCCCGCCTCCCTGCAGAGAACCAGGTG...CAGAGGAGAA

   6700     .    :    .    :    .    :    .    :    .    :
   6596 GGGGCCGGCCACGTGGGAATAACCTCAGT         ACCATCTCAGAC
        |||||||||||||||||||||||||||||>>>...>>>||||||||||||
 295580 GGGGCCGGCCACGTGGGAATAACCTCAGTGTA...CAGACCATCTCAGAC

   6750     .    :    .    :    .    :    .    :    .    :
   6637 ACCAGCCCCATGAAGCGTTCAGCCTCCGTGCTGGGCCCCAAGGCCCGACG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 296739 ACCAGCCCCATGAAGCGTTCAGCCTCCGTGCTGGGCCCCAAGGCCCGACG

   6800     .    :    .    :    .    :    .    :    .    :
   6687 CCTGGACGATTACTCGCTGGAGCGGGTCCCGCCCGAGGAGAACCAGCGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 296789 CCTGGACGATTACTCGCTGGAGCGGGTCCCGCCCGAGGAGAACCAGCGGC

   6850     .    :    .    :    .    :    .    :    .    :
   6737 ACCACCAGCGGCGCCGCGACCGCAGCCACCGCGCCTCTGAGCGCTCCCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 296839 ACCACCAGCGGCGCCGCGACCGCAGCCACCGCGCCTCTGAGCGCTCCCTG

   6900     .    :    .    :    .    :    .    :    .    :
   6787 GGCCGCTACACCGATGTGGACACAG         GCTTGGGGACAGACCT
        |||||||||||||||||||||||||>>>...>>>||||||||||||||||
 296889 GGCCGCTACACCGATGTGGACACAGGTG...CAGGCTTGGGGACAGACCT

   6950     .    :    .    :    .    :    .    :    .    :
   6828 GAGCATGACCACCCAATCCGGGGACCTGCCGTCGAAGGAGCGGGACCAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 297232 GAGCATGACCACCCAATCCGGGGACCTGCCGTCGAAGGAGCGGGACCAGG

   7000     .    :    .    :    .    :    .    :    .    :
   6878 AGCGGGGCCGGCCCAAGGATCGGAAGCATCGACAGCACCACCACCACCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 297282 AGCGGGGCCGGCCCAAGGATCGGAAGCATCGACAGCACCACCACCACCAC

   7050     .    :    .    :    .    :    .    :    .    :
   6928 CACCACCACCACCATCCCCCGCCCCCCGACAAGGACCGCTATGCCCAGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 297332 CACCACCACCACCATCCCCCGCCCCCCGACAAGGACCGCTATGCCCAGGA

   7100     .    :    .    :    .    :    .    :    .    :
   6978 ACGGCCGGACCACGGCCGGGCACGGGCTCGGGACCAGCGCTGGTCCCGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 297382 ACGGCCGGACCACGGCCGGGCACGGGCTCGGGACCAGCGCTGGTCCCGCT

   7150     .    :    .    :    .    :    .    :    .    :
   7028 CGCCCAGCGAGGGCCGAGAGCACATGGCGCACCGGCAG         GGC
        ||||||||||||||||||||||||||||||||||||||>>>...>>>|||
 297432 CGCCCAGCGAGGGCCGAGAGCACATGGCGCACCGGCAGGTG...TAGGGC

   7200     .    :    .    :    .    :    .    :    .    :
   7069 AGTAGTTCCGTAAGTGGAAGCCCAGCCCCCTCAACATCTGGTACCAGCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298175 AGTAGTTCCGTAAGTGGAAGCCCAGCCCCCTCAACATCTGGTACCAGCAC

   7250     .    :    .    :    .    :    .    :    .    :
   7119 TCCGCGGCGGGGCCGCCGCCAGCTCCCCCAGACCCCCTCCACCCCCCGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298225 TCCGCGGCGGGGCCGCCGCCAGCTCCCCCAGACCCCCTCCACCCCCCGGC

   7300     .    :    .    :    .    :    .    :    .    :
   7169 CACACGTGTCCTATTCCCCTGTGATCCGTAAGGCCGGCGGCTCGGGGCCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298275 CACACGTGTCCTATTCCCCTGTGATCCGTAAGGCCGGCGGCTCGGGGCCC

   7350     .    :    .    :    .    :    .    :    .    :
   7219    C  C GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGGCGGTGGC
        ---|--|-||||||||||||||||||||||||||||||||||||||||||
 298325 CCGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGGCGGTGGC

   7400     .    :    .    :    .    :    .    :    .    :
   7263 CAGGCCGGGCCGGGCGGCCACCAGCGGCCCTCGGAGGTACCCAGGCCCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298375 CAGGCCGGGCCGGGCGGCCACCAGCGGCCCTCGGAGGTACCCAGGCCCCA

   7450     .    :    .    :    .    :    .    :    .    :
   7313 CGGCCGAGCCTCTGGCCGGAGATCGGCCGCCCACGGGGGGCCACAGCAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298425 CGGCCGAGCCTCTGGCCGGAGATCGGCCGCCCACGGGGGGCCACAGCAGC

   7500     .    :    .    :    .    :    .    :    .    :
   7363 GGCCGCTCGCCCAGGATGGAGAGGCGGGTCCCAGGCCCGGCCCGGAGCGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298475 GGCCGCTCGCCCAGGATGGAGAGGCGGGTCCCAGGCCCGGCCCGGAGCGA

   7550     .    :    .    :    .    :    .    :    .    :
   7413 GTCCCCCAGGGCCTGTCGACACGGCGGGGCCCGGTGGCCGGCATCTGGCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298525 GTCCCCCAGGGCCTGTCGACACGGCGGGGCCCGGTGGCCGGCATCTGGCC

   7600     .    :    .    :    .    :    .    :    .    :
   7463 CGCACGTGTCCGAGGGGCCCCCGGGTCCCCGGCACCATGGCTACTACCGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298575 CGCACGTGTCCGAGGGGCCCCCGGGTCCCCGGCACCATGGCTACTACCGG

   7650     .    :    .    :    .    :    .    :    .    :
   7513 GGCTCCGACTACGACGAGGCCGATGGCCCGGGCAGCGGGGGCGGCGAGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298625 GGCTCCGACTACGACGAGGCCGATGGCCCGGGCAGCGGGGGCGGCGAGGA

   7700     .    :    .    :    .    :    .    :    .    :
   7563 GGCCATGGCCGGGGCCTACGACGCGCCACCCCCCGTACGACACGCGTCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298675 GGCCATGGCCGGGGCCTACGACGCGCCACCCCCCGTACGACACGCGTCCT

   7750     .    :    .    :    .    :    .    :    .    :
   7613 CGGGCGCCACCGGGCGCTCGCCCAGGACTCCCCGGGCCTCGGGCCCGGCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298725 CGGGCGCCACCGGGCGCTCGCCCAGGACTCCCCGGGCCTCGGGCCCGGCC

   7800     .    :    .    :    .    :    .    :    .    :
   7663 TGCGCCTCGCCTTCTCGGCACGGCCGGCGACTCCCCAACGGCTACTACCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298775 TGCGCCTCGCCTTCTCGGCACGGCCGGCGACTCCCCAACGGCTACTACCC

   7850     .    :    .    :    .    :    .    :    .    :
   7713 GGCGCACGGACTGGCCAGGCCCCGCGGGCCGGGCTCCAGGAAGGGCCTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298825 GGCGCACGGACTGGCCAGGCCCCGCGGGCCGGGCTCCAGGAAGGGCCTGC

   7900     .    :    .    :    .    :    .    :    .    :
   7763 ACGAACCCTACAGCGAGAGTGACGATGATTGGTGCTAAGCCCGGGCGAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298875 ACGAACCCTACAGCGAGAGTGACGATGATTGGTGCTAAGCCCGGGCGAGG

END