Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: NM_007302.1
Subject Sequence ID: ENSG00000012048
Subject Sequence type: 2


seq1 = /RAID/mart2/Splice/public_html/fasta/rna.fa/NM_00/NM_007302.1, 6986 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000012048 (ENSG00000012048), 81091 bp

>gi|6552314|ref|NM_007302.1| Homo sapiens breast cancer 1, early onset (BRCA1), transcript variant BRCA1-delta9-10, mRNA
>ENSG00000012048

(complement)

1-122  (1-121)   95% ->
123-221  (1277-1375)   100% ->
222-275  (9613-9666)   100% ->
276-353  (18859-18936)   100% ->
354-442  (20436-20524)   100% ->
443-582  (21131-21270)   100% ->
583-688  (25512-25617)   100% ->
689-4114  (30532-33957)   100% ->
4115-4203  (34360-34448)   100% ->
4204-4375  (42817-42988)   100% ->
4376-4502  (48778-48904)   100% ->
4503-4693  (50871-51061)   100% ->
4694-5004  (54154-54464)   100% ->
5005-5092  (57697-57784)   100% ->
5093-5170  (61441-61518)   100% ->
5171-5211  (62019-62059)   100% ->
5212-5295  (68257-68340)   100% ->
5296-5350  (74275-74329)   100% ->
5351-5424  (76198-76271)   100% ->
5425-5485  (77689-77749)   100% ->
5486-6985  (79590-81091)   99%

      0     .    :    .    :    .    :    .    :    .    :
      1 AAAACTGCGACTGCGCGGCGTGAGCTCGCTGAGACTTCCTGGACCCCGCA
        ||||||||||||||||||||||||||||||||||||||||||||   | |
      1 AAAACTGCGACTGCGCGGCGTGAGCTCGCTGAGACTTCCTGGACGGGGGA

     50     .    :    .    :    .    :    .    :    .    :
     51 CCAGGCTGTGGGGTTTCTCAGATAACTGGGCCCCTGCGCTCAGGAGGCCT
        |-||||||||||||||||||||||||||||||||||||||||||||||||
     51 C AGGCTGTGGGGTTTCTCAGATAACTGGGCCCCTGCGCTCAGGAGGCCT

    100     .    :    .    :    .    :    .    :    .    :
    101 TCACCCTCTGCTCTGGGTAAAG         TTCATTGGAACAGAAAGAA
        ||||||||||||||||||||||>>>...>>>|||||||||||||||||||
    100 TCACCCTCTGCTCTGGGTAAAGGTA...AAGTTCATTGGAACAGAAAGAA

    150     .    :    .    :    .    :    .    :    .    :
    142 ATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   1296 ATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGC

    200     .    :    .    :    .    :    .    :    .    :
    192 TATGCAGAAAATCTTAGAGTGTCCCATCTG         TCTGGAGTTGA
        ||||||||||||||||||||||||||||||>>>...>>>|||||||||||
   1346 TATGCAGAAAATCTTAGAGTGTCCCATCTGGTA...TAGTCTGGAGTTGA

    250     .    :    .    :    .    :    .    :    .    :
    233 TCAAGGAACCTGTCTCCACAAAGTGTGACCACATATTTTGCAA       
        |||||||||||||||||||||||||||||||||||||||||||>>>...>
   9624 TCAAGGAACCTGTCTCCACAAAGTGTGACCACATATTTTGCAAGTA...T

    300     .    :    .    :    .    :    .    :    .    :
    276   ATTTTGCATGCTGAAACTTCTCAACCAGAAGAAAGGGCCTTCACAGTG
        >>||||||||||||||||||||||||||||||||||||||||||||||||
  18857 AGATTTTGCATGCTGAAACTTCTCAACCAGAAGAAAGGGCCTTCACAGTG

    350     .    :    .    :    .    :    .    :    .    :
    324 TCCTTTATGTAAGAATGATATAACCAAAAG         GAGCCTACAAG
        ||||||||||||||||||||||||||||||>>>...>>>|||||||||||
  18907 TCCTTTATGTAAGAATGATATAACCAAAAGGTA...CAGGAGCCTACAAG

    400     .    :    .    :    .    :    .    :    .    :
    365 AAAGTACGAGATTTAGTCAACTTGTTGAAGAGCTATTGAAAATCATTTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  20447 AAAGTACGAGATTTAGTCAACTTGTTGAAGAGCTATTGAAAATCATTTGT

    450     .    :    .    :    .    :    .    :    .    :
    415 GCTTTTCAGCTTGACACAGGTTTGGAGT         ATGCAAACAGCTA
        ||||||||||||||||||||||||||||>>>...>>>|||||||||||||
  20497 GCTTTTCAGCTTGACACAGGTTTGGAGTGTA...CAGATGCAAACAGCTA

    500     .    :    .    :    .    :    .    :    .    :
    456 TAATTTTGCAAAAAAGGAAAATAACTCTCCTGAACATCTAAAAGATGAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  21144 TAATTTTGCAAAAAAGGAAAATAACTCTCCTGAACATCTAAAAGATGAAG

    550     .    :    .    :    .    :    .    :    .    :
    506 TTTCTATCATCCAAAGTATGGGCTACAGAAACCGTGCCAAAAGACTTCTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  21194 TTTCTATCATCCAAAGTATGGGCTACAGAAACCGTGCCAAAAGACTTCTA

    600     .    :    .    :    .    :    .    :    .    :
    556 CAGAGTGAACCCGAAAATCCTTCCTTG         CAGGAAACCAGTCT
        |||||||||||||||||||||||||||>>>...>>>||||||||||||||
  21244 CAGAGTGAACCCGAAAATCCTTCCTTGGTA...TAGCAGGAAACCAGTCT

    650     .    :    .    :    .    :    .    :    .    :
    597 CAGTGTCCAACTCTCTAACCTTGGAACTGTGAGAACTCTGAGGACAAAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  25526 CAGTGTCCAACTCTCTAACCTTGGAACTGTGAGAACTCTGAGGACAAAGC

    700     .    :    .    :    .    :    .    :    .    :
    647 AGCGGATACAACCTCAAAAGACGTCTGTCTACATTGAATTGG        
        ||||||||||||||||||||||||||||||||||||||||||>>>...>>
  25576 AGCGGATACAACCTCAAAAGACGTCTGTCTACATTGAATTGGGTA...CA

    750     .    :    .    :    .    :    .    :    .    :
    689  CTGCTTGTGAATTTTCTGAGACGGATGTAACAAATACTGAACATCATCA
        >|||||||||||||||||||||||||||||||||||||||||||||||||
  30531 GCTGCTTGTGAATTTTCTGAGACGGATGTAACAAATACTGAACATCATCA

    800     .    :    .    :    .    :    .    :    .    :
    738 ACCCAGTAATAATGATTTGAACACCACTGAGAAGCGTGCAGCTGAGAGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  30581 ACCCAGTAATAATGATTTGAACACCACTGAGAAGCGTGCAGCTGAGAGGC

    850     .    :    .    :    .    :    .    :    .    :
    788 ATCCAGAAAAGTATCAGGGTAGTTCTGTTTCAAACTTGCATGTGGAGCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  30631 ATCCAGAAAAGTATCAGGGTAGTTCTGTTTCAAACTTGCATGTGGAGCCA

    900     .    :    .    :    .    :    .    :    .    :
    838 TGTGGCACAAATACTCATGCCAGCTCATTACAGCATGAGAACAGCAGTTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  30681 TGTGGCACAAATACTCATGCCAGCTCATTACAGCATGAGAACAGCAGTTT

    950     .    :    .    :    .    :    .    :    .    :
    888 ATTACTCACTAAAGACAGAATGAATGTAGAAAAGGCTGAATTCTGTAATA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  30731 ATTACTCACTAAAGACAGAATGAATGTAGAAAAGGCTGAATTCTGTAATA

   1000     .    :    .    :    .    :    .    :    .    :
    938 AAAGCAAACAGCCTGGCTTAGCAAGGAGCCAACATAACAGATGGGCTGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  30781 AAAGCAAACAGCCTGGCTTAGCAAGGAGCCAACATAACAGATGGGCTGGA

   1050     .    :    .    :    .    :    .    :    .    :
    988 AGTAAGGAAACATGTAATGATAGGCGGACTCCCAGCACAGAAAAAAAGGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  30831 AGTAAGGAAACATGTAATGATAGGCGGACTCCCAGCACAGAAAAAAAGGT

   1100     .    :    .    :    .    :    .    :    .    :
   1038 AGATCTGAATGCTGATCCCCTGTGTGAGAGAAAAGAATGGAATAAGCAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  30881 AGATCTGAATGCTGATCCCCTGTGTGAGAGAAAAGAATGGAATAAGCAGA

   1150     .    :    .    :    .    :    .    :    .    :
   1088 AACTGCCATGCTCAGAGAATCCTAGAGATACTGAAGATGTTCCTTGGATA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  30931 AACTGCCATGCTCAGAGAATCCTAGAGATACTGAAGATGTTCCTTGGATA

   1200     .    :    .    :    .    :    .    :    .    :
   1138 ACACTAAATAGCAGCATTCAGAAAGTTAATGAGTGGTTTTCCAGAAGTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  30981 ACACTAAATAGCAGCATTCAGAAAGTTAATGAGTGGTTTTCCAGAAGTGA

   1250     .    :    .    :    .    :    .    :    .    :
   1188 TGAACTGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATCAAATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31031 TGAACTGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATCAAATG

   1300     .    :    .    :    .    :    .    :    .    :
   1238 CCAAAGTAGCTGATGTATTGGACGTTCTAAATGAGGTAGATGAATATTCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31081 CCAAAGTAGCTGATGTATTGGACGTTCTAAATGAGGTAGATGAATATTCT

   1350     .    :    .    :    .    :    .    :    .    :
   1288 GGTTCTTCAGAGAAAATAGACTTACTGGCCAGTGATCCTCATGAGGCTTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31131 GGTTCTTCAGAGAAAATAGACTTACTGGCCAGTGATCCTCATGAGGCTTT

   1400     .    :    .    :    .    :    .    :    .    :
   1338 AATATGTAAAAGTGAAAGAGTTCACTCCAAATCAGTAGAGAGTAATATTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31181 AATATGTAAAAGTGAAAGAGTTCACTCCAAATCAGTAGAGAGTAATATTG

   1450     .    :    .    :    .    :    .    :    .    :
   1388 AAGACAAAATATTTGGGAAAACCTATCGGAAGAAGGCAAGCCTCCCCAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31231 AAGACAAAATATTTGGGAAAACCTATCGGAAGAAGGCAAGCCTCCCCAAC

   1500     .    :    .    :    .    :    .    :    .    :
   1438 TTAAGCCATGTAACTGAAAATCTAATTATAGGAGCATTTGTTACTGAGCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31281 TTAAGCCATGTAACTGAAAATCTAATTATAGGAGCATTTGTTACTGAGCC

   1550     .    :    .    :    .    :    .    :    .    :
   1488 ACAGATAATACAAGAGCGTCCCCTCACAAATAAATTAAAGCGTAAAAGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31331 ACAGATAATACAAGAGCGTCCCCTCACAAATAAATTAAAGCGTAAAAGGA

   1600     .    :    .    :    .    :    .    :    .    :
   1538 GACCTACATCAGGCCTTCATCCTGAGGATTTTATCAAGAAAGCAGATTTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31381 GACCTACATCAGGCCTTCATCCTGAGGATTTTATCAAGAAAGCAGATTTG

   1650     .    :    .    :    .    :    .    :    .    :
   1588 GCAGTTCAAAAGACTCCTGAAATGATAAATCAGGGAACTAACCAAACGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31431 GCAGTTCAAAAGACTCCTGAAATGATAAATCAGGGAACTAACCAAACGGA

   1700     .    :    .    :    .    :    .    :    .    :
   1638 GCAGAATGGTCAAGTGATGAATATTACTAATAGTGGTCATGAGAATAAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31481 GCAGAATGGTCAAGTGATGAATATTACTAATAGTGGTCATGAGAATAAAA

   1750     .    :    .    :    .    :    .    :    .    :
   1688 CAAAAGGTGATTCTATTCAGAATGAGAAAAATCCTAACCCAATAGAATCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31531 CAAAAGGTGATTCTATTCAGAATGAGAAAAATCCTAACCCAATAGAATCA

   1800     .    :    .    :    .    :    .    :    .    :
   1738 CTCGAAAAAGAATCTGCTTTCAAAACGAAAGCTGAACCTATAAGCAGCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31581 CTCGAAAAAGAATCTGCTTTCAAAACGAAAGCTGAACCTATAAGCAGCAG

   1850     .    :    .    :    .    :    .    :    .    :
   1788 TATAAGCAATATGGAACTCGAATTAAATATCCACAATTCAAAAGCACCTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31631 TATAAGCAATATGGAACTCGAATTAAATATCCACAATTCAAAAGCACCTA

   1900     .    :    .    :    .    :    .    :    .    :
   1838 AAAAGAATAGGCTGAGGAGGAAGTCTTCTACCAGGCATATTCATGCGCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31681 AAAAGAATAGGCTGAGGAGGAAGTCTTCTACCAGGCATATTCATGCGCTT

   1950     .    :    .    :    .    :    .    :    .    :
   1888 GAACTAGTAGTCAGTAGAAATCTAAGCCCACCTAATTGTACTGAATTGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31731 GAACTAGTAGTCAGTAGAAATCTAAGCCCACCTAATTGTACTGAATTGCA

   2000     .    :    .    :    .    :    .    :    .    :
   1938 AATTGATAGTTGTTCTAGCAGTGAAGAGATAAAGAAAAAAAAGTACAACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31781 AATTGATAGTTGTTCTAGCAGTGAAGAGATAAAGAAAAAAAAGTACAACC

   2050     .    :    .    :    .    :    .    :    .    :
   1988 AAATGCCAGTCAGGCACAGCAGAAACCTACAACTCATGGAAGGTAAAGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31831 AAATGCCAGTCAGGCACAGCAGAAACCTACAACTCATGGAAGGTAAAGAA

   2100     .    :    .    :    .    :    .    :    .    :
   2038 CCTGCAACTGGAGCCAAGAAGAGTAACAAGCCAAATGAACAGACAAGTAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31881 CCTGCAACTGGAGCCAAGAAGAGTAACAAGCCAAATGAACAGACAAGTAA

   2150     .    :    .    :    .    :    .    :    .    :
   2088 AAGACATGACAGCGATACTTTCCCAGAGCTGAAGTTAACAAATGCACCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31931 AAGACATGACAGCGATACTTTCCCAGAGCTGAAGTTAACAAATGCACCTG

   2200     .    :    .    :    .    :    .    :    .    :
   2138 GTTCTTTTACTAAGTGTTCAAATACCAGTGAACTTAAAGAATTTGTCAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31981 GTTCTTTTACTAAGTGTTCAAATACCAGTGAACTTAAAGAATTTGTCAAT

   2250     .    :    .    :    .    :    .    :    .    :
   2188 CCTAGCCTTCCAAGAGAAGAAAAAGAAGAGAAACTAGAAACAGTTAAAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32031 CCTAGCCTTCCAAGAGAAGAAAAAGAAGAGAAACTAGAAACAGTTAAAGT

   2300     .    :    .    :    .    :    .    :    .    :
   2238 GTCTAATAATGCTGAAGACCCCAAAGATCTCATGTTAAGTGGAGAAAGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32081 GTCTAATAATGCTGAAGACCCCAAAGATCTCATGTTAAGTGGAGAAAGGG

   2350     .    :    .    :    .    :    .    :    .    :
   2288 TTTTGCAAACTGAAAGATCTGTAGAGAGTAGCAGTATTTCATTGGTACCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32131 TTTTGCAAACTGAAAGATCTGTAGAGAGTAGCAGTATTTCATTGGTACCT

   2400     .    :    .    :    .    :    .    :    .    :
   2338 GGTACTGATTATGGCACTCAGGAAAGTATCTCGTTACTGGAAGTTAGCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32181 GGTACTGATTATGGCACTCAGGAAAGTATCTCGTTACTGGAAGTTAGCAC

   2450     .    :    .    :    .    :    .    :    .    :
   2388 TCTAGGGAAGGCAAAAACAGAACCAAATAAATGTGTGAGTCAGTGTGCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32231 TCTAGGGAAGGCAAAAACAGAACCAAATAAATGTGTGAGTCAGTGTGCAG

   2500     .    :    .    :    .    :    .    :    .    :
   2438 CATTTGAAAACCCCAAGGGACTAATTCATGGTTGTTCCAAAGATAATAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32281 CATTTGAAAACCCCAAGGGACTAATTCATGGTTGTTCCAAAGATAATAGA

   2550     .    :    .    :    .    :    .    :    .    :
   2488 AATGACACAGAAGGCTTTAAGTATCCATTGGGACATGAAGTTAACCACAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32331 AATGACACAGAAGGCTTTAAGTATCCATTGGGACATGAAGTTAACCACAG

   2600     .    :    .    :    .    :    .    :    .    :
   2538 TCGGGAAACAAGCATAGAAATGGAAGAAAGTGAACTTGATGCTCAGTATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32381 TCGGGAAACAAGCATAGAAATGGAAGAAAGTGAACTTGATGCTCAGTATT

   2650     .    :    .    :    .    :    .    :    .    :
   2588 TGCAGAATACATTCAAGGTTTCAAAGCGCCAGTCATTTGCTCCGTTTTCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32431 TGCAGAATACATTCAAGGTTTCAAAGCGCCAGTCATTTGCTCCGTTTTCA

   2700     .    :    .    :    .    :    .    :    .    :
   2638 AATCCAGGAAATGCAGAAGAGGAATGTGCAACATTCTCTGCCCACTCTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32481 AATCCAGGAAATGCAGAAGAGGAATGTGCAACATTCTCTGCCCACTCTGG

   2750     .    :    .    :    .    :    .    :    .    :
   2688 GTCCTTAAAGAAACAAAGTCCAAAAGTCACTTTTGAATGTGAACAAAAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32531 GTCCTTAAAGAAACAAAGTCCAAAAGTCACTTTTGAATGTGAACAAAAGG

   2800     .    :    .    :    .    :    .    :    .    :
   2738 AAGAAAATCAAGGAAAGAATGAGTCTAATATCAAGCCTGTACAGACAGTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32581 AAGAAAATCAAGGAAAGAATGAGTCTAATATCAAGCCTGTACAGACAGTT

   2850     .    :    .    :    .    :    .    :    .    :
   2788 AATATCACTGCAGGCTTTCCTGTGGTTGGTCAGAAAGATAAGCCAGTTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32631 AATATCACTGCAGGCTTTCCTGTGGTTGGTCAGAAAGATAAGCCAGTTGA

   2900     .    :    .    :    .    :    .    :    .    :
   2838 TAATGCCAAATGTAGTATCAAAGGAGGCTCTAGGTTTTGTCTATCATCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32681 TAATGCCAAATGTAGTATCAAAGGAGGCTCTAGGTTTTGTCTATCATCTC

   2950     .    :    .    :    .    :    .    :    .    :
   2888 AGTTCAGAGGCAACGAAACTGGACTCATTACTCCAAATAAACATGGACTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32731 AGTTCAGAGGCAACGAAACTGGACTCATTACTCCAAATAAACATGGACTT

   3000     .    :    .    :    .    :    .    :    .    :
   2938 TTACAAAACCCATATCGTATACCACCACTTTTTCCCATCAAGTCATTTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32781 TTACAAAACCCATATCGTATACCACCACTTTTTCCCATCAAGTCATTTGT

   3050     .    :    .    :    .    :    .    :    .    :
   2988 TAAAACTAAATGTAAGAAAAATCTGCTAGAGGAAAACTTTGAGGAACATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32831 TAAAACTAAATGTAAGAAAAATCTGCTAGAGGAAAACTTTGAGGAACATT

   3100     .    :    .    :    .    :    .    :    .    :
   3038 CAATGTCACCTGAAAGAGAAATGGGAAATGAGAACATTCCAAGTACAGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32881 CAATGTCACCTGAAAGAGAAATGGGAAATGAGAACATTCCAAGTACAGTG

   3150     .    :    .    :    .    :    .    :    .    :
   3088 AGCACAATTAGCCGTAATAACATTAGAGAAAATGTTTTTAAAGAAGCCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32931 AGCACAATTAGCCGTAATAACATTAGAGAAAATGTTTTTAAAGAAGCCAG

   3200     .    :    .    :    .    :    .    :    .    :
   3138 CTCAAGCAATATTAATGAAGTAGGTTCCAGTACTAATGAAGTGGGCTCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32981 CTCAAGCAATATTAATGAAGTAGGTTCCAGTACTAATGAAGTGGGCTCCA

   3250     .    :    .    :    .    :    .    :    .    :
   3188 GTATTAATGAAATAGGTTCCAGTGATGAAAACATTCAAGCAGAACTAGGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33031 GTATTAATGAAATAGGTTCCAGTGATGAAAACATTCAAGCAGAACTAGGT

   3300     .    :    .    :    .    :    .    :    .    :
   3238 AGAAACAGAGGGCCAAAATTGAATGCTATGCTTAGATTAGGGGTTTTGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33081 AGAAACAGAGGGCCAAAATTGAATGCTATGCTTAGATTAGGGGTTTTGCA

   3350     .    :    .    :    .    :    .    :    .    :
   3288 ACCTGAGGTCTATAAACAAAGTCTTCCTGGAAGTAATTGTAAGCATCCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33131 ACCTGAGGTCTATAAACAAAGTCTTCCTGGAAGTAATTGTAAGCATCCTG

   3400     .    :    .    :    .    :    .    :    .    :
   3338 AAATAAAAAAGCAAGAATATGAAGAAGTAGTTCAGACTGTTAATACAGAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33181 AAATAAAAAAGCAAGAATATGAAGAAGTAGTTCAGACTGTTAATACAGAT

   3450     .    :    .    :    .    :    .    :    .    :
   3388 TTCTCTCCATATCTGATTTCAGATAACTTAGAACAGCCTATGGGAAGTAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33231 TTCTCTCCATATCTGATTTCAGATAACTTAGAACAGCCTATGGGAAGTAG

   3500     .    :    .    :    .    :    .    :    .    :
   3438 TCATGCATCTCAGGTTTGTTCTGAGACACCTGATGACCTGTTAGATGATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33281 TCATGCATCTCAGGTTTGTTCTGAGACACCTGATGACCTGTTAGATGATG

   3550     .    :    .    :    .    :    .    :    .    :
   3488 GTGAAATAAAGGAAGATACTAGTTTTGCTGAAAATGACATTAAGGAAAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33331 GTGAAATAAAGGAAGATACTAGTTTTGCTGAAAATGACATTAAGGAAAGT

   3600     .    :    .    :    .    :    .    :    .    :
   3538 TCTGCTGTTTTTAGCAAAAGCGTCCAGAAAGGAGAGCTTAGCAGGAGTCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33381 TCTGCTGTTTTTAGCAAAAGCGTCCAGAAAGGAGAGCTTAGCAGGAGTCC

   3650     .    :    .    :    .    :    .    :    .    :
   3588 TAGCCCTTTCACCCATACACATTTGGCTCAGGGTTACCGAAGAGGGGCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33431 TAGCCCTTTCACCCATACACATTTGGCTCAGGGTTACCGAAGAGGGGCCA

   3700     .    :    .    :    .    :    .    :    .    :
   3638 AGAAATTAGAGTCCTCAGAAGAGAACTTATCTAGTGAGGATGAAGAGCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33481 AGAAATTAGAGTCCTCAGAAGAGAACTTATCTAGTGAGGATGAAGAGCTT

   3750     .    :    .    :    .    :    .    :    .    :
   3688 CCCTGCTTCCAACACTTGTTATTTGGTAAAGTAAACAATATACCTTCTCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33531 CCCTGCTTCCAACACTTGTTATTTGGTAAAGTAAACAATATACCTTCTCA

   3800     .    :    .    :    .    :    .    :    .    :
   3738 GTCTACTAGGCATAGCACCGTTGCTACCGAGTGTCTGTCTAAGAACACAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33581 GTCTACTAGGCATAGCACCGTTGCTACCGAGTGTCTGTCTAAGAACACAG

   3850     .    :    .    :    .    :    .    :    .    :
   3788 AGGAGAATTTATTATCATTGAAGAATAGCTTAAATGACTGCAGTAACCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33631 AGGAGAATTTATTATCATTGAAGAATAGCTTAAATGACTGCAGTAACCAG

   3900     .    :    .    :    .    :    .    :    .    :
   3838 GTAATATTGGCAAAGGCATCTCAGGAACATCACCTTAGTGAGGAAACAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33681 GTAATATTGGCAAAGGCATCTCAGGAACATCACCTTAGTGAGGAAACAAA

   3950     .    :    .    :    .    :    .    :    .    :
   3888 ATGTTCTGCTAGCTTGTTTTCTTCACAGTGCAGTGAATTGGAAGACTTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33731 ATGTTCTGCTAGCTTGTTTTCTTCACAGTGCAGTGAATTGGAAGACTTGA

   4000     .    :    .    :    .    :    .    :    .    :
   3938 CTGCAAATACAAACACCCAGGATCCTTTCTTGATTGGTTCTTCCAAACAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33781 CTGCAAATACAAACACCCAGGATCCTTTCTTGATTGGTTCTTCCAAACAA

   4050     .    :    .    :    .    :    .    :    .    :
   3988 ATGAGGCATCAGTCTGAAAGCCAGGGAGTTGGTCTGAGTGACAAGGAATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33831 ATGAGGCATCAGTCTGAAAGCCAGGGAGTTGGTCTGAGTGACAAGGAATT

   4100     .    :    .    :    .    :    .    :    .    :
   4038 GGTTTCAGATGATGAAGAAAGAGGAACGGGCTTGGAAGAAAATAATCAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33881 GGTTTCAGATGATGAAGAAAGAGGAACGGGCTTGGAAGAAAATAATCAAG

   4150     .    :    .    :    .    :    .    :    .    :
   4088 AAGAGCAAAGCATGGATTCAAACTTAG         GTGAAGCAGCATCT
        |||||||||||||||||||||||||||>>>...>>>||||||||||||||
  33931 AAGAGCAAAGCATGGATTCAAACTTAGGTA...AAGGTGAAGCAGCATCT

   4200     .    :    .    :    .    :    .    :    .    :
   4129 GGGTGTGAGAGTGAAACAAGCGTCTCTGAAGACTGCTCAGGGCTATCCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  34374 GGGTGTGAGAGTGAAACAAGCGTCTCTGAAGACTGCTCAGGGCTATCCTC

   4250     .    :    .    :    .    :    .    :    .    :
   4179 TCAGAGTGACATTTTAACCACTCAG         CAGAGGGATACCATGC
        |||||||||||||||||||||||||>>>...>>>||||||||||||||||
  34424 TCAGAGTGACATTTTAACCACTCAGGTA...AAGCAGAGGGATACCATGC

   4300     .    :    .    :    .    :    .    :    .    :
   4220 AACATAACCTGATAAAGCTCCAGCAGGAAATGGCTGAACTAGAAGCTGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  42833 AACATAACCTGATAAAGCTCCAGCAGGAAATGGCTGAACTAGAAGCTGTG

   4350     .    :    .    :    .    :    .    :    .    :
   4270 TTAGAACAGCATGGGAGCCAGCCTTCTAACAGCTACCCTTCCATCATAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  42883 TTAGAACAGCATGGGAGCCAGCCTTCTAACAGCTACCCTTCCATCATAAG

   4400     .    :    .    :    .    :    .    :    .    :
   4320 TGACTCTTCTGCCCTTGAGGACCTGCGAAATCCAGAACAAAGCACATCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  42933 TGACTCTTCTGCCCTTGAGGACCTGCGAAATCCAGAACAAAGCACATCAG

   4450     .    :    .    :    .    :    .    :    .    :
   4370 AAAAAG         CAGTATTAACTTCACAGAAAAGTAGTGAATACCCT
        ||||||>>>...>>>|||||||||||||||||||||||||||||||||||
  42983 AAAAAGGTG...AAGCAGTATTAACTTCACAGAAAAGTAGTGAATACCCT

   4500     .    :    .    :    .    :    .    :    .    :
   4411 ATAAGCCAGAATCCAGAAGGCCTTTCTGCTGACAAGTTTGAGGTGTCTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  48813 ATAAGCCAGAATCCAGAAGGCCTTTCTGCTGACAAGTTTGAGGTGTCTGC

   4550     .    :    .    :    .    :    .    :    .    :
   4461 AGATAGTTCTACCAGTAAAAATAAAGAACCAGGAGTGGAAAG        
        ||||||||||||||||||||||||||||||||||||||||||>>>...>>
  48863 AGATAGTTCTACCAGTAAAAATAAAGAACCAGGAGTGGAAAGGTA...TA

   4600     .    :    .    :    .    :    .    :    .    :
   4503  GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCAC
        >|||||||||||||||||||||||||||||||||||||||||||||||||
  50870 GGTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCAC

   4650     .    :    .    :    .    :    .    :    .    :
   4552 AGTTGCTCTGGGAGTCTTCAGAATAGAAACTACCCATCTCAAGAGGAGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  50920 AGTTGCTCTGGGAGTCTTCAGAATAGAAACTACCCATCTCAAGAGGAGCT

   4700     .    :    .    :    .    :    .    :    .    :
   4602 CATTAAGGTTGTTGATGTGGAGGAGCAACAGCTGGAAGAGTCTGGGCCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  50970 CATTAAGGTTGTTGATGTGGAGGAGCAACAGCTGGAAGAGTCTGGGCCAC

   4750     .    :    .    :    .    :    .    :    .    :
   4652 ACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG        
        ||||||||||||||||||||||||||||||||||||||||||>>>...>>
  51020 ACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAGGTA...CA

   4800     .    :    .    :    .    :    .    :    .    :
   4694  AGGGAACCCCTTACCTGGAATCTGGAATCAGCCTCTTCTCTGATGACCC
        >|||||||||||||||||||||||||||||||||||||||||||||||||
  54153 GAGGGAACCCCTTACCTGGAATCTGGAATCAGCCTCTTCTCTGATGACCC

   4850     .    :    .    :    .    :    .    :    .    :
   4743 TGAATCTGATCCTTCTGAAGACAGAGCCCCAGAGTCAGCTCGTGTTGGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54203 TGAATCTGATCCTTCTGAAGACAGAGCCCCAGAGTCAGCTCGTGTTGGCA

   4900     .    :    .    :    .    :    .    :    .    :
   4793 ACATACCATCTTCAACCTCTGCATTGAAAGTTCCCCAATTGAAAGTTGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54253 ACATACCATCTTCAACCTCTGCATTGAAAGTTCCCCAATTGAAAGTTGCA

   4950     .    :    .    :    .    :    .    :    .    :
   4843 GAATCTGCCCAGAGTCCAGCTGCTGCTCATACTACTGATACTGCTGGGTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54303 GAATCTGCCCAGAGTCCAGCTGCTGCTCATACTACTGATACTGCTGGGTA

   5000     .    :    .    :    .    :    .    :    .    :
   4893 TAATGCAATGGAAGAAAGTGTGAGCAGGGAGAAGCCAGAATTGACAGCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54353 TAATGCAATGGAAGAAAGTGTGAGCAGGGAGAAGCCAGAATTGACAGCTT

   5050     .    :    .    :    .    :    .    :    .    :
   4943 CAACAGAAAGGGTCAACAAAAGAATGTCCATGGTGGTGTCTGGCCTGACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54403 CAACAGAAAGGGTCAACAAAAGAATGTCCATGGTGGTGTCTGGCCTGACC

   5100     .    :    .    :    .    :    .    :    .    :
   4993 CCAGAAGAATTT         ATGCTCGTGTACAAGTTTGCCAGAAAACA
        ||||||||||||>>>...>>>|||||||||||||||||||||||||||||
  54453 CCAGAAGAATTTGTG...CAGATGCTCGTGTACAAGTTTGCCAGAAAACA

   5150     .    :    .    :    .    :    .    :    .    :
   5034 CCACATCACTTTAACTAATCTAATTACTGAAGAGACTACTCATGTTGTTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  57726 CCACATCACTTTAACTAATCTAATTACTGAAGAGACTACTCATGTTGTTA

   5200     .    :    .    :    .    :    .    :    .    :
   5084 TGAAAACAG         ATGCTGAGTTTGTGTGTGAACGGACACTGAAA
        |||||||||>>>...>>>||||||||||||||||||||||||||||||||
  57776 TGAAAACAGGTA...CAGATGCTGAGTTTGTGTGTGAACGGACACTGAAA

   5250     .    :    .    :    .    :    .    :    .    :
   5125 TATTTTCTAGGAATTGCGGGAGGAAAATGGGTAGTTAGCTATTTCT    
        ||||||||||||||||||||||||||||||||||||||||||||||>>>.
  61473 TATTTTCTAGGAATTGCGGGAGGAAAATGGGTAGTTAGCTATTTCTGTA.

   5300     .    :    .    :    .    :    .    :    .    :
   5171      GGGTGACCCAGTCTATTAAAGAAAGAAAAATGCTGAATGAG    
        ..>>>|||||||||||||||||||||||||||||||||||||||||>>>.
  61523 ..TAGGGGTGACCCAGTCTATTAAAGAAAGAAAAATGCTGAATGAGGTA.

   5350     .    :    .    :    .    :    .    :    .    :
   5212      CATGATTTTGAAGTCAGAGGAGATGTGGTCAATGGAAGAAACCAC
        ..>>>|||||||||||||||||||||||||||||||||||||||||||||
  62064 ..CAGCATGATTTTGAAGTCAGAGGAGATGTGGTCAATGGAAGAAACCAC

   5400     .    :    .    :    .    :    .    :    .    :
   5257 CAAGGTCCAAAGCGAGCAAGAGAATCCCAGGACAGAAAG         AT
        |||||||||||||||||||||||||||||||||||||||>>>...>>>||
  68302 CAAGGTCCAAAGCGAGCAAGAGAATCCCAGGACAGAAAGGTA...CAGAT

   5450     .    :    .    :    .    :    .    :    .    :
   5298 CTTCAGGGGGCTAGAAATCTGTTGCTATGGGCCCTTCACCAACATGCCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  74277 CTTCAGGGGGCTAGAAATCTGTTGCTATGGGCCCTTCACCAACATGCCCA

   5500     .    :    .    :    .    :    .    :    .    :
   5348 CAG         ATCAACTGGAATGGATGGTACAGCTGTGTGGTGCTTCT
        |||>>>...>>>||||||||||||||||||||||||||||||||||||||
  74327 CAGGTA...TAGATCAACTGGAATGGATGGTACAGCTGTGTGGTGCTTCT

   5550     .    :    .    :    .    :    .    :    .    :
   5389 GTGGTGAAGGAGCTTTCATCATTCACCCTTGGCACA         GGTGT
        ||||||||||||||||||||||||||||||||||||>>>...>>>|||||
  76236 GTGGTGAAGGAGCTTTCATCATTCACCCTTGGCACAGTA...CAGGGTGT

   5600     .    :    .    :    .    :    .    :    .    :
   5430 CCACCCAATTGTGGTTGTGCAGCCAGATGCCTGGACAGAGGACAATGGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  77694 CCACCCAATTGTGGTTGTGCAGCCAGATGCCTGGACAGAGGACAATGGCT

   5650     .    :    .    :    .    :    .    :    .    :
   5480 TCCATG         CAATTGGGCAGATGTGTGAGGCACCTGTGGTGACC
        ||||||>>>...>>>|||||||||||||||||||||||||||||||||||
  77744 TCCATGGTA...CAGCAATTGGGCAGATGTGTGAGGCACCTGTGGTGACC

   5700     .    :    .    :    .    :    .    :    .    :
   5521 CGAGAGTGGGTGTTGGACAGTGTAGCACTCTACCAGTGCCAGGAGCTGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79625 CGAGAGTGGGTGTTGGACAGTGTAGCACTCTACCAGTGCCAGGAGCTGGA

   5750     .    :    .    :    .    :    .    :    .    :
   5571 CACCTACCTGATACCCCAGATCCCCCACAGCCACTACTGACTGCAGCCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79675 CACCTACCTGATACCCCAGATCCCCCACAGCCACTACTGACTGCAGCCAG

   5800     .    :    .    :    .    :    .    :    .    :
   5621 CCACAGGTACAGAGCCACAG ACCCCAAGAATGAGCTTACAAAGTGGCCT
        ||||||||||||||||||||-|||||||||||||||||||||||||||||
  79725 CCACAGGTACAGAGCCACAGGACCCCAAGAATGAGCTTACAAAGTGGCCT

   5850     .    :    .    :    .    :    .    :    .    :
   5670 TTCCAGGCCCTGGGAGCTCCTCTCACTCTTCAGTCCTTCTACTGTCCTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79775 TTCCAGGCCCTGGGAGCTCCTCTCACTCTTCAGTCCTTCTACTGTCCTGG

   5900     .    :    .    :    .    :    .    :    .    :
   5720 CTACTAAATATTTTATGTACATCAGCCTGAAAAGGACTTCTGGCTATGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79825 CTACTAAATATTTTATGTACATCAGCCTGAAAAGGACTTCTGGCTATGCA

   5950     .    :    .    :    .    :    .    :    .    :
   5770 AGGGTCCCTTAAAGATTTTCTGCTTGAAGTCTCCCTTGGAAATCTGCCAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79875 AGGGTCCCTTAAAGATTTTCTGCTTGAAGTCTCCCTTGGAAATCTGCCAT

   6000     .    :    .    :    .    :    .    :    .    :
   5820 GAGCACAAAATTATGGTAATTTTTCACCTGAGAAGATTTTAAAACCATTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79925 GAGCACAAAATTATGGTAATTTTTCACCTGAGAAGATTTTAAAACCATTT

   6050     .    :    .    :    .    :    .    :    .    :
   5870 AAACGCCACCAATTGAGCAAGATGCTGATTCATTATTTATCAGCCCTATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79975 AAACGCCACCAATTGAGCAAGATGCTGATTCATTATTTATCAGCCCTATT

   6100     .    :    .    :    .    :    .    :    .    :
   5920 CTTTCTATTCAGGCTGTTGTTGGCTTAGGGCTGGAAGCACAGAGTGGCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80025 CTTTCTATTCAGGCTGTTGTTGGCTTAGGGCTGGAAGCACAGAGTGGCTT

   6150     .    :    .    :    .    :    .    :    .    :
   5970 GGCCTCAAGAGAATAGCTGGTTTCCCTAAGTTTACTTCTCTAAAACCCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80075 GGCCTCAAGAGAATAGCTGGTTTCCCTAAGTTTACTTCTCTAAAACCCTG

   6200     .    :    .    :    .    :    .    :    .    :
   6020 TGTTCACAAAGGCAGAGAGTCAGACCCTTCAATGGAAGGAGAGTGCTTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80125 TGTTCACAAAGGCAGAGAGTCAGACCCTTCAATGGAAGGAGAGTGCTTGG

   6250     .    :    .    :    .    :    .    :    .    :
   6070 GATCGATTATGTGACTTAAAGTCAGAATAGTCCTTGGGCAGTTCTCAAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80175 GATCGATTATGTGACTTAAAGTCAGAATAGTCCTTGGGCAGTTCTCAAAT

   6300     .    :    .    :    .    :    .    :    .    :
   6120 GTTGGAGTGGAACATTGGGGAGGAAATTCTGAGGCAGGTATTAGAAATGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80225 GTTGGAGTGGAACATTGGGGAGGAAATTCTGAGGCAGGTATTAGAAATGA

   6350     .    :    .    :    .    :    .    :    .    :
   6170 AAAGGAAACTTGAAACCTGGGCATGGTGGCTCACGCCTGTAATCCCAGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80275 AAAGGAAACTTGAAACCTGGGCATGGTGGCTCACGCCTGTAATCCCAGCA

   6400     .    :    .    :    .    :    .    :    .    :
   6220 CTTTGGGAGGCCAAGGTGGGCAGATCACTGGAGGTCAGGAGTTCGAAACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80325 CTTTGGGAGGCCAAGGTGGGCAGATCACTGGAGGTCAGGAGTTCGAAACC

   6450     .    :    .    :    .    :    .    :    .    :
   6270 AGCCTGGCCAACATGGTGAAACCCCATCTCTACTAAAAATACAGAAATTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80375 AGCCTGGCCAACATGGTGAAACCCCATCTCTACTAAAAATACAGAAATTA

   6500     .    :    .    :    .    :    .    :    .    :
   6320 GCCGGTCATGGTGGTGGACACCTGTAATCCCAGCTACTCAGGTGGCTAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80425 GCCGGTCATGGTGGTGGACACCTGTAATCCCAGCTACTCAGGTGGCTAAG

   6550     .    :    .    :    .    :    .    :    .    :
   6370 GCAGGAGAATCACTTCAGCCCGGGAGGTGGAGGTTGCAGTGAGCCAAGAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80475 GCAGGAGAATCACTTCAGCCCGGGAGGTGGAGGTTGCAGTGAGCCAAGAT

   6600     .    :    .    :    .    :    .    :    .    :
   6420 CATACCACGGCACTCCAGCCTGGGTGACAGTGAGACTGTGGCTCAAAAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80525 CATACCACGGCACTCCAGCCTGGGTGACAGTGAGACTGTGGCTCAAAAAA

   6650     .    :    .    :    .    :    .    :    .    :
   6470 AAAAAAAAAAAA GGAAAATGAAACTAGGAAAGGTTTCTTAAAGTCTGAG
        ||||||||||||-||||||||||||||| | || ||||| ||||||||||
  80575 AAAAAAAAAAAAAGGAAAATGAAACTAGAAGAGATTTCTAAAAGTCTGAG

   6700     .    :    .    :    .    :    .    :    .    :
   6519 ATATATTTGCTAGATTTCTAAAGAATGTGTTCTAAAACAGCAGAAGATTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80625 ATATATTTGCTAGATTTCTAAAGAATGTGTTCTAAAACAGCAGAAGATTT

   6750     .    :    .    :    .    :    .    :    .    :
   6569 TCAAGAACCGGTTTCCAAAGACAGTCTTCTAATTCCTCATTAGTAATAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80675 TCAAGAACCGGTTTCCAAAGACAGTCTTCTAATTCCTCATTAGTAATAAG

   6800     .    :    .    :    .    :    .    :    .    :
   6619 TAAAATGTTTATTGTTGTAGCTCTGGTATATAATCCATTCCTCTTAAAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80725 TAAAATGTTTATTGTTGTAGCTCTGGTATATAATCCATTCCTCTTAAAAT

   6850     .    :    .    :    .    :    .    :    .    :
   6669 ATAAGACCTCTGGCATGAATATTTCATATCTATAAAATGACAGATCCCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80775 ATAAGACCTCTGGCATGAATATTTCATATCTATAAAATGACAGATCCCAC

   6900     .    :    .    :    .    :    .    :    .    :
   6719 CAGGAAGGAAGCTGTTGCTTTCTTTGAGGTGATTTTTTTCCTTTGCTCCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80825 CAGGAAGGAAGCTGTTGCTTTCTTTGAGGTGATTTTTTTCCTTTGCTCCC

   6950     .    :    .    :    .    :    .    :    .    :
   6769 TGTTGCTGAAACCATACAGCTTCATAAATAATTTTGCTTGCTGAAGGAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80875 TGTTGCTGAAACCATACAGCTTCATAAATAATTTTGCTTGCTGAAGGAAG

   7000     .    :    .    :    .    :    .    :    .    :
   6819 AAAAAGTGTTTTTCATAAACCCATTATCCAGGACTGTTTATAGCTGTTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80925 AAAAAGTGTTTTTCATAAACCCATTATCCAGGACTGTTTATAGCTGTTGG

   7050     .    :    .    :    .    :    .    :    .    :
   6869 AAGGACTAGGTCTTCCCTAGCCCCCCCAGTGTGCAAGGGCAGTGAAGACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80975 AAGGACTAGGTCTTCCCTAGCCCCCCCAGTGTGCAAGGGCAGTGAAGACT

   7100     .    :    .    :    .    :    .    :    .    :
   6919 TGATTGTACAAAATACGTTTTGTAAATGTTGTGCTGTTAACACTGCAAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  81025 TGATTGTACAAAATACGTTTTGTAAATGTTGTGCTGTTAACACTGCAAAT

   7150     .    :    .
   6969 AAACTTGGTAGCAAACA
        |||||||||||||||||
  81075 AAACTTGGTAGCAAACA

END