Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: NM_007298.1
Subject Sequence ID: ENSG00000012048
Subject Sequence type: 2


seq1 = /RAID/mart2/Splice/public_html/fasta/rna.fa/NM_00/NM_007298.1, 3559 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000012048 (ENSG00000012048), 81091 bp

>gi|6552306|ref|NM_007298.1| Homo sapiens breast cancer 1, early onset (BRCA1), transcript variant BRCA1-delta9-11, mRNA
>ENSG00000012048

(complement)

1-122  (1-121)   95% ->
123-221  (1277-1375)   100% ->
222-275  (9613-9666)   100% ->
276-353  (18859-18936)   100% ->
354-442  (20436-20524)   100% ->
443-582  (21131-21270)   100% ->
583-688  (25512-25617)   100% ->
689-777  (34360-34448)   100% ->
778-949  (42817-42988)   100% ->
950-1076  (48778-48904)   100% ->
1077-1267  (50871-51061)   100% ->
1268-1578  (54154-54464)   100% ->
1579-1666  (57697-57784)   100% ->
1667-1744  (61441-61518)   100% ->
1745-1785  (62019-62059)   100% ->
1786-1869  (68257-68340)   100% ->
1870-1924  (74275-74329)   100% ->
1925-1998  (76198-76271)   100% ->
1999-2059  (77689-77749)   100% ->
2060-3559  (79590-81091)   99%

      0     .    :    .    :    .    :    .    :    .    :
      1 AAAACTGCGACTGCGCGGCGTGAGCTCGCTGAGACTTCCTGGACCCCGCA
        ||||||||||||||||||||||||||||||||||||||||||||   | |
      1 AAAACTGCGACTGCGCGGCGTGAGCTCGCTGAGACTTCCTGGACGGGGGA

     50     .    :    .    :    .    :    .    :    .    :
     51 CCAGGCTGTGGGGTTTCTCAGATAACTGGGCCCCTGCGCTCAGGAGGCCT
        |-||||||||||||||||||||||||||||||||||||||||||||||||
     51 C AGGCTGTGGGGTTTCTCAGATAACTGGGCCCCTGCGCTCAGGAGGCCT

    100     .    :    .    :    .    :    .    :    .    :
    101 TCACCCTCTGCTCTGGGTAAAG         TTCATTGGAACAGAAAGAA
        ||||||||||||||||||||||>>>...>>>|||||||||||||||||||
    100 TCACCCTCTGCTCTGGGTAAAGGTA...AAGTTCATTGGAACAGAAAGAA

    150     .    :    .    :    .    :    .    :    .    :
    142 ATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   1296 ATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGC

    200     .    :    .    :    .    :    .    :    .    :
    192 TATGCAGAAAATCTTAGAGTGTCCCATCTG         TCTGGAGTTGA
        ||||||||||||||||||||||||||||||>>>...>>>|||||||||||
   1346 TATGCAGAAAATCTTAGAGTGTCCCATCTGGTA...TAGTCTGGAGTTGA

    250     .    :    .    :    .    :    .    :    .    :
    233 TCAAGGAACCTGTCTCCACAAAGTGTGACCACATATTTTGCAA       
        |||||||||||||||||||||||||||||||||||||||||||>>>...>
   9624 TCAAGGAACCTGTCTCCACAAAGTGTGACCACATATTTTGCAAGTA...T

    300     .    :    .    :    .    :    .    :    .    :
    276   ATTTTGCATGCTGAAACTTCTCAACCAGAAGAAAGGGCCTTCACAGTG
        >>||||||||||||||||||||||||||||||||||||||||||||||||
  18857 AGATTTTGCATGCTGAAACTTCTCAACCAGAAGAAAGGGCCTTCACAGTG

    350     .    :    .    :    .    :    .    :    .    :
    324 TCCTTTATGTAAGAATGATATAACCAAAAG         GAGCCTACAAG
        ||||||||||||||||||||||||||||||>>>...>>>|||||||||||
  18907 TCCTTTATGTAAGAATGATATAACCAAAAGGTA...CAGGAGCCTACAAG

    400     .    :    .    :    .    :    .    :    .    :
    365 AAAGTACGAGATTTAGTCAACTTGTTGAAGAGCTATTGAAAATCATTTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  20447 AAAGTACGAGATTTAGTCAACTTGTTGAAGAGCTATTGAAAATCATTTGT

    450     .    :    .    :    .    :    .    :    .    :
    415 GCTTTTCAGCTTGACACAGGTTTGGAGT         ATGCAAACAGCTA
        ||||||||||||||||||||||||||||>>>...>>>|||||||||||||
  20497 GCTTTTCAGCTTGACACAGGTTTGGAGTGTA...CAGATGCAAACAGCTA

    500     .    :    .    :    .    :    .    :    .    :
    456 TAATTTTGCAAAAAAGGAAAATAACTCTCCTGAACATCTAAAAGATGAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  21144 TAATTTTGCAAAAAAGGAAAATAACTCTCCTGAACATCTAAAAGATGAAG

    550     .    :    .    :    .    :    .    :    .    :
    506 TTTCTATCATCCAAAGTATGGGCTACAGAAACCGTGCCAAAAGACTTCTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  21194 TTTCTATCATCCAAAGTATGGGCTACAGAAACCGTGCCAAAAGACTTCTA

    600     .    :    .    :    .    :    .    :    .    :
    556 CAGAGTGAACCCGAAAATCCTTCCTTG         CAGGAAACCAGTCT
        |||||||||||||||||||||||||||>>>...>>>||||||||||||||
  21244 CAGAGTGAACCCGAAAATCCTTCCTTGGTA...TAGCAGGAAACCAGTCT

    650     .    :    .    :    .    :    .    :    .    :
    597 CAGTGTCCAACTCTCTAACCTTGGAACTGTGAGAACTCTGAGGACAAAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  25526 CAGTGTCCAACTCTCTAACCTTGGAACTGTGAGAACTCTGAGGACAAAGC

    700     .    :    .    :    .    :    .    :    .    :
    647 AGCGGATACAACCTCAAAAGACGTCTGTCTACATTGAATTGG        
        ||||||||||||||||||||||||||||||||||||||||||>>>...>>
  25576 AGCGGATACAACCTCAAAAGACGTCTGTCTACATTGAATTGGGTA...AA

    750     .    :    .    :    .    :    .    :    .    :
    689  GTGAAGCAGCATCTGGGTGTGAGAGTGAAACAAGCGTCTCTGAAGACTG
        >|||||||||||||||||||||||||||||||||||||||||||||||||
  34359 GGTGAAGCAGCATCTGGGTGTGAGAGTGAAACAAGCGTCTCTGAAGACTG

    800     .    :    .    :    .    :    .    :    .    :
    738 CTCAGGGCTATCCTCTCAGAGTGACATTTTAACCACTCAG         C
        ||||||||||||||||||||||||||||||||||||||||>>>...>>>|
  34409 CTCAGGGCTATCCTCTCAGAGTGACATTTTAACCACTCAGGTA...AAGC

    850     .    :    .    :    .    :    .    :    .    :
    779 AGAGGGATACCATGCAACATAACCTGATAAAGCTCCAGCAGGAAATGGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  42818 AGAGGGATACCATGCAACATAACCTGATAAAGCTCCAGCAGGAAATGGCT

    900     .    :    .    :    .    :    .    :    .    :
    829 GAACTAGAAGCTGTGTTAGAACAGCATGGGAGCCAGCCTTCTAACAGCTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  42868 GAACTAGAAGCTGTGTTAGAACAGCATGGGAGCCAGCCTTCTAACAGCTA

    950     .    :    .    :    .    :    .    :    .    :
    879 CCCTTCCATCATAAGTGACTCTTCTGCCCTTGAGGACCTGCGAAATCCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  42918 CCCTTCCATCATAAGTGACTCTTCTGCCCTTGAGGACCTGCGAAATCCAG

   1000     .    :    .    :    .    :    .    :    .    :
    929 AACAAAGCACATCAGAAAAAG         CAGTATTAACTTCACAGAAA
        |||||||||||||||||||||>>>...>>>||||||||||||||||||||
  42968 AACAAAGCACATCAGAAAAAGGTG...AAGCAGTATTAACTTCACAGAAA

   1050     .    :    .    :    .    :    .    :    .    :
    970 AGTAGTGAATACCCTATAAGCCAGAATCCAGAAGGCCTTTCTGCTGACAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  48798 AGTAGTGAATACCCTATAAGCCAGAATCCAGAAGGCCTTTCTGCTGACAA

   1100     .    :    .    :    .    :    .    :    .    :
   1020 GTTTGAGGTGTCTGCAGATAGTTCTACCAGTAAAAATAAAGAACCAGGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  48848 GTTTGAGGTGTCTGCAGATAGTTCTACCAGTAAAAATAAAGAACCAGGAG

   1150     .    :    .    :    .    :    .    :    .    :
   1070 TGGAAAG         GTCATCCCCTTCTAAATGCCCATCATTAGATGAT
        |||||||>>>...>>>||||||||||||||||||||||||||||||||||
  48898 TGGAAAGGTA...TAGGTCATCCCCTTCTAAATGCCCATCATTAGATGAT

   1200     .    :    .    :    .    :    .    :    .    :
   1111 AGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAGAATAGAAACTACCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  50905 AGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAGAATAGAAACTACCC

   1250     .    :    .    :    .    :    .    :    .    :
   1161 ATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGCAACAGCTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  50955 ATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGCAACAGCTGG

   1300     .    :    .    :    .    :    .    :    .    :
   1211 AAGAGTCTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  51005 AAGAGTCTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAA

   1350     .    :    .    :    .    :    .    :    .    :
   1261 GATCTAG         AGGGAACCCCTTACCTGGAATCTGGAATCAGCCT
        |||||||>>>...>>>||||||||||||||||||||||||||||||||||
  51055 GATCTAGGTA...CAGAGGGAACCCCTTACCTGGAATCTGGAATCAGCCT

   1400     .    :    .    :    .    :    .    :    .    :
   1302 CTTCTCTGATGACCCTGAATCTGATCCTTCTGAAGACAGAGCCCCAGAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54188 CTTCTCTGATGACCCTGAATCTGATCCTTCTGAAGACAGAGCCCCAGAGT

   1450     .    :    .    :    .    :    .    :    .    :
   1352 CAGCTCGTGTTGGCAACATACCATCTTCAACCTCTGCATTGAAAGTTCCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54238 CAGCTCGTGTTGGCAACATACCATCTTCAACCTCTGCATTGAAAGTTCCC

   1500     .    :    .    :    .    :    .    :    .    :
   1402 CAATTGAAAGTTGCAGAATCTGCCCAGAGTCCAGCTGCTGCTCATACTAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54288 CAATTGAAAGTTGCAGAATCTGCCCAGAGTCCAGCTGCTGCTCATACTAC

   1550     .    :    .    :    .    :    .    :    .    :
   1452 TGATACTGCTGGGTATAATGCAATGGAAGAAAGTGTGAGCAGGGAGAAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54338 TGATACTGCTGGGTATAATGCAATGGAAGAAAGTGTGAGCAGGGAGAAGC

   1600     .    :    .    :    .    :    .    :    .    :
   1502 CAGAATTGACAGCTTCAACAGAAAGGGTCAACAAAAGAATGTCCATGGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54388 CAGAATTGACAGCTTCAACAGAAAGGGTCAACAAAAGAATGTCCATGGTG

   1650     .    :    .    :    .    :    .    :    .    :
   1552 GTGTCTGGCCTGACCCCAGAAGAATTT         ATGCTCGTGTACAA
        |||||||||||||||||||||||||||>>>...>>>||||||||||||||
  54438 GTGTCTGGCCTGACCCCAGAAGAATTTGTG...CAGATGCTCGTGTACAA

   1700     .    :    .    :    .    :    .    :    .    :
   1593 GTTTGCCAGAAAACACCACATCACTTTAACTAATCTAATTACTGAAGAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  57711 GTTTGCCAGAAAACACCACATCACTTTAACTAATCTAATTACTGAAGAGA

   1750     .    :    .    :    .    :    .    :    .    :
   1643 CTACTCATGTTGTTATGAAAACAG         ATGCTGAGTTTGTGTGT
        ||||||||||||||||||||||||>>>...>>>|||||||||||||||||
  57761 CTACTCATGTTGTTATGAAAACAGGTA...CAGATGCTGAGTTTGTGTGT

   1800     .    :    .    :    .    :    .    :    .    :
   1684 GAACGGACACTGAAATATTTTCTAGGAATTGCGGGAGGAAAATGGGTAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  61458 GAACGGACACTGAAATATTTTCTAGGAATTGCGGGAGGAAAATGGGTAGT

   1850     .    :    .    :    .    :    .    :    .    :
   1734 TAGCTATTTCT         GGGTGACCCAGTCTATTAAAGAAAGAAAAA
        |||||||||||>>>...>>>||||||||||||||||||||||||||||||
  61508 TAGCTATTTCTGTA...TAGGGGTGACCCAGTCTATTAAAGAAAGAAAAA

   1900     .    :    .    :    .    :    .    :    .    :
   1775 TGCTGAATGAG         CATGATTTTGAAGTCAGAGGAGATGTGGTC
        |||||||||||>>>...>>>||||||||||||||||||||||||||||||
  62049 TGCTGAATGAGGTA...CAGCATGATTTTGAAGTCAGAGGAGATGTGGTC

   1950     .    :    .    :    .    :    .    :    .    :
   1816 AATGGAAGAAACCACCAAGGTCCAAAGCGAGCAAGAGAATCCCAGGACAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  68287 AATGGAAGAAACCACCAAGGTCCAAAGCGAGCAAGAGAATCCCAGGACAG

   2000     .    :    .    :    .    :    .    :    .    :
   1866 AAAG         ATCTTCAGGGGGCTAGAAATCTGTTGCTATGGGCCCT
        ||||>>>...>>>|||||||||||||||||||||||||||||||||||||
  68337 AAAGGTA...CAGATCTTCAGGGGGCTAGAAATCTGTTGCTATGGGCCCT

   2050     .    :    .    :    .    :    .    :    .    :
   1907 TCACCAACATGCCCACAG         ATCAACTGGAATGGATGGTACAG
        ||||||||||||||||||>>>...>>>|||||||||||||||||||||||
  74312 TCACCAACATGCCCACAGGTA...TAGATCAACTGGAATGGATGGTACAG

   2100     .    :    .    :    .    :    .    :    .    :
   1948 CTGTGTGGTGCTTCTGTGGTGAAGGAGCTTTCATCATTCACCCTTGGCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  76221 CTGTGTGGTGCTTCTGTGGTGAAGGAGCTTTCATCATTCACCCTTGGCAC

   2150     .    :    .    :    .    :    .    :    .    :
   1998 A         GGTGTCCACCCAATTGTGGTTGTGCAGCCAGATGCCTGGA
        |>>>...>>>||||||||||||||||||||||||||||||||||||||||
  76271 AGTA...CAGGGTGTCCACCCAATTGTGGTTGTGCAGCCAGATGCCTGGA

   2200     .    :    .    :    .    :    .    :    .    :
   2039 CAGAGGACAATGGCTTCCATG         CAATTGGGCAGATGTGTGAG
        |||||||||||||||||||||>>>...>>>||||||||||||||||||||
  77729 CAGAGGACAATGGCTTCCATGGTA...CAGCAATTGGGCAGATGTGTGAG

   2250     .    :    .    :    .    :    .    :    .    :
   2080 GCACCTGTGGTGACCCGAGAGTGGGTGTTGGACAGTGTAGCACTCTACCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79610 GCACCTGTGGTGACCCGAGAGTGGGTGTTGGACAGTGTAGCACTCTACCA

   2300     .    :    .    :    .    :    .    :    .    :
   2130 GTGCCAGGAGCTGGACACCTACCTGATACCCCAGATCCCCCACAGCCACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79660 GTGCCAGGAGCTGGACACCTACCTGATACCCCAGATCCCCCACAGCCACT

   2350     .    :    .    :    .    :    .    :    .    :
   2180 ACTGACTGCAGCCAGCCACAGGTACAGAGC ACAGGACCCCAAGAATGAG
        ||||||||||||||||||||||||||||||-|||||||||||||||||||
  79710 ACTGACTGCAGCCAGCCACAGGTACAGAGCCACAGGACCCCAAGAATGAG

   2400     .    :    .    :    .    :    .    :    .    :
   2229 CTTACAAAGTGGCCTTTCCAGGCCCTGGGAGCTCCTCTCACTCTTCAGTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79760 CTTACAAAGTGGCCTTTCCAGGCCCTGGGAGCTCCTCTCACTCTTCAGTC

   2450     .    :    .    :    .    :    .    :    .    :
   2279 CTTCTACTGTCCTGGCTACTAAATATTTTATGTACATCAGCCTGAAAAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79810 CTTCTACTGTCCTGGCTACTAAATATTTTATGTACATCAGCCTGAAAAGG

   2500     .    :    .    :    .    :    .    :    .    :
   2329 ACTTCTGGCTATGCAAGGGTCCCTTAAAGATTTTCTGCTTGAAGTCTCCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79860 ACTTCTGGCTATGCAAGGGTCCCTTAAAGATTTTCTGCTTGAAGTCTCCC

   2550     .    :    .    :    .    :    .    :    .    :
   2379 TTGGAAATCTGCCATGAGCACAAAATTATGGTAATTTTTCACCTGAGAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79910 TTGGAAATCTGCCATGAGCACAAAATTATGGTAATTTTTCACCTGAGAAG

   2600     .    :    .    :    .    :    .    :    .    :
   2429 ATTTTAAAACCATTTAAACGCCACCAATTGAGCAAGATGCTGATTCATTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79960 ATTTTAAAACCATTTAAACGCCACCAATTGAGCAAGATGCTGATTCATTA

   2650     .    :    .    :    .    :    .    :    .    :
   2479 TTTATCAGCCCTATTCTTTCTATTCAGGCTGTTGTTGGCTTAGGGCTGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80010 TTTATCAGCCCTATTCTTTCTATTCAGGCTGTTGTTGGCTTAGGGCTGGA

   2700     .    :    .    :    .    :    .    :    .    :
   2529 AGCACAGAGTGGCTTGGCCTCAAGAGAATAGCTGGTTTCCCTAAGTTTAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80060 AGCACAGAGTGGCTTGGCCTCAAGAGAATAGCTGGTTTCCCTAAGTTTAC

   2750     .    :    .    :    .    :    .    :    .    :
   2579 TTCTCTAAAACCCTGTGTTCACAAAGGCAGAGAGTCAGACCCTTCAATGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80110 TTCTCTAAAACCCTGTGTTCACAAAGGCAGAGAGTCAGACCCTTCAATGG

   2800     .    :    .    :    .    :    .    :    .    :
   2629 AAGGAGAGTGCTTGGGATCGATTATGTGACTTAAAGTCAGAATAGTCCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80160 AAGGAGAGTGCTTGGGATCGATTATGTGACTTAAAGTCAGAATAGTCCTT

   2850     .    :    .    :    .    :    .    :    .    :
   2679 GGGCAGTTCTCAAATGTTGGAGTGGAACATTGGGGAGGAAATTCTGAGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80210 GGGCAGTTCTCAAATGTTGGAGTGGAACATTGGGGAGGAAATTCTGAGGC

   2900     .    :    .    :    .    :    .    :    .    :
   2729 AGGTATTAGAAATGAAAAGGAAACTTGAAACCTGGGCATGGTGGCTCACG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80260 AGGTATTAGAAATGAAAAGGAAACTTGAAACCTGGGCATGGTGGCTCACG

   2950     .    :    .    :    .    :    .    :    .    :
   2779 CCTGTAATCCCAGCACTTTGGGAGGCCAAGGTGGGCAGATCACTGGAGGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80310 CCTGTAATCCCAGCACTTTGGGAGGCCAAGGTGGGCAGATCACTGGAGGT

   3000     .    :    .    :    .    :    .    :    .    :
   2829 CAGGAGTTCGAAACCAGCCTGGCCAACATGGTGAAACCCCATCTCTACTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80360 CAGGAGTTCGAAACCAGCCTGGCCAACATGGTGAAACCCCATCTCTACTA

   3050     .    :    .    :    .    :    .    :    .    :
   2879 AAAATACAGAAATTAGCCGGTCATGGTGGTGGACACCTGTAATCCCAGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80410 AAAATACAGAAATTAGCCGGTCATGGTGGTGGACACCTGTAATCCCAGCT

   3100     .    :    .    :    .    :    .    :    .    :
   2929 ACTCAGGTGGCTAAGGCAGGAGAATCACTTCAGCCCGGGAGGTGGAGGTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80460 ACTCAGGTGGCTAAGGCAGGAGAATCACTTCAGCCCGGGAGGTGGAGGTT

   3150     .    :    .    :    .    :    .    :    .    :
   2979 GCAGTGAGCCAAGATCATACCACGGCACTCCAGCCTGGGTGACAGTGAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80510 GCAGTGAGCCAAGATCATACCACGGCACTCCAGCCTGGGTGACAGTGAGA

   3200     .    :    .    :    .    :    .    :    .    :
   3029 CTGTGGCTCAAAAAAAAAAAAAAAAAA GGAAAATGAAACTAGGAAAGGT
        |||||||||||||||||||||||||||-||||||||||||||| | || |
  80560 CTGTGGCTCAAAAAAAAAAAAAAAAAAAGGAAAATGAAACTAGAAGAGAT

   3250     .    :    .    :    .    :    .    :    .    :
   3078 TTCTTAAAGTCTGAGATATATTTGCTAGATTTCTAAAGAATGTGTTCTAA
        |||| |||||||||||||||||||||||||||||||||||||||||||||
  80610 TTCTAAAAGTCTGAGATATATTTGCTAGATTTCTAAAGAATGTGTTCTAA

   3300     .    :    .    :    .    :    .    :    .    :
   3128 AACAGCAGAAGATTTTCAAGAACCGGTTTCCAAAGACAGTCTTCTAATTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80660 AACAGCAGAAGATTTTCAAGAACCGGTTTCCAAAGACAGTCTTCTAATTC

   3350     .    :    .    :    .    :    .    :    .    :
   3178 CTCATTAGTAATAAGTAAAATGTTTATTGTTGTAGCTCTGGTATATAATC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80710 CTCATTAGTAATAAGTAAAATGTTTATTGTTGTAGCTCTGGTATATAATC

   3400     .    :    .    :    .    :    .    :    .    :
   3228 CATTCCTCTTAAAATATAAGACCTCTGGCATGAATATTTCATATCTATAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80760 CATTCCTCTTAAAATATAAGACCTCTGGCATGAATATTTCATATCTATAA

   3450     .    :    .    :    .    :    .    :    .    :
   3278 AATGACAGATCCCACCAGGAAGGAAGCTGTTGCTTTCTTTGAGGTGATTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80810 AATGACAGATCCCACCAGGAAGGAAGCTGTTGCTTTCTTTGAGGTGATTT

   3500     .    :    .    :    .    :    .    :    .    :
   3328 TTTTCCTTTGCTCCCTGTTGCTGAAACCATACAGCTTCATAAATAATTTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80860 TTTTCCTTTGCTCCCTGTTGCTGAAACCATACAGCTTCATAAATAATTTT

   3550     .    :    .    :    .    :    .    :    .    :
   3378 GCTTGCTGAAGGAAGAAAAAGTGTTTTTCATAAACCCATTATCCAGGACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80910 GCTTGCTGAAGGAAGAAAAAGTGTTTTTCATAAACCCATTATCCAGGACT

   3600     .    :    .    :    .    :    .    :    .    :
   3428 GTTTATAGCTGTTGGAAGGACTAGGTCTTCCCTAGCCCCCCCAGTGTGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80960 GTTTATAGCTGTTGGAAGGACTAGGTCTTCCCTAGCCCCCCCAGTGTGCA

   3650     .    :    .    :    .    :    .    :    .    :
   3478 AGGGCAGTGAAGACTTGATTGTACAAAATACGTTTTGTAAATGTTGTGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  81010 AGGGCAGTGAAGACTTGATTGTACAAAATACGTTTTGTAAATGTTGTGCT

   3700     .    :    .    :    .    :
   3528 GTTAACACTGCAAATAAACTTGGTAGCAAACA
        ||||||||||||||||||||||||||||||||
  81060 GTTAACACTGCAAATAAACTTGGTAGCAAACA

END