Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: NM_000059.1
Subject Sequence ID: ENSG00000139618
Subject Sequence type: 2


seq1 = /RAID/mart2/Splice/public_html/fasta/rna.fa/NM_00/NM_000059.1, 10987 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000139618 (ENSG00000139618), 84189 bp

>gi|4502450|ref|NM_000059.1| Homo sapiens breast cancer 2, early onset (BRCA2), mRNA
>ENSG00000139618

2-189  (1-188)   100% ->
190-295  (943-1048)   100% ->
296-544  (3598-3846)   100% ->
545-653  (9597-9705)   100% ->
654-703  (10622-10671)   100% ->
704-744  (10763-10803)   100% ->
745-859  (11020-11134)   100% ->
860-909  (13964-14013)   100% ->
910-1021  (15440-15551)   100% ->
1022-2137  (16793-17908)   99% ->
2138-7069  (20786-25717)   99% ->
7070-7165  (29079-29174)   100% ->
7166-7235  (31348-31417)   100% ->
7236-7663  (39382-39809)   99% ->
7664-7845  (40949-41130)   100% ->
7846-8033  (42263-42450)   100% ->
8034-8204  (47044-47214)   100% ->
8205-8559  (47700-48054)   100% ->
8560-8715  (54923-55078)   100% ->
8716-8860  (55477-55621)   100% ->
8861-8982  (61191-61312)   100% ->
8983-9181  (63838-64036)   100% ->
9182-9345  (64271-64434)   100% ->
9346-9484  (64528-64666)   100% ->
9485-9729  (79210-79454)   100% ->
9730-9876  (81419-81565)   100% ->
9877-10926  (82683-83731)   99% ->
10927-10986  (84130-84189)   98%

      0     .    :    .    :    .    :    .    :    .    :
      2 GTGGCGCGAGCTTCTGAAACTAGGCGGCAGAGGCGGAGCCGCTGTGGCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      1 GTGGCGCGAGCTTCTGAAACTAGGCGGCAGAGGCGGAGCCGCTGTGGCAC

     50     .    :    .    :    .    :    .    :    .    :
     52 TGCTGCGCCTCTGCTGCGCCTCGGGTGTCTTTTGCGGCGGTGGGTCGCCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     51 TGCTGCGCCTCTGCTGCGCCTCGGGTGTCTTTTGCGGCGGTGGGTCGCCG

    100     .    :    .    :    .    :    .    :    .    :
    102 CCGGGAGAAGCGTGAGGGGACAGATTTGTGACCGGCGCGGTTTTTGTCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    101 CCGGGAGAAGCGTGAGGGGACAGATTTGTGACCGGCGCGGTTTTTGTCAG

    150     .    :    .    :    .    :    .    :    .    :
    152 CTTACTCCGGCCAAAAAAGAACTGCACCTCTGGAGCGG         ACT
        ||||||||||||||||||||||||||||||||||||||>>>...>>>|||
    151 CTTACTCCGGCCAAAAAAGAACTGCACCTCTGGAGCGGGTT...CAGACT

    200     .    :    .    :    .    :    .    :    .    :
    193 TATTTACCAAGCATTGGAGGAATATCGTAGGTAAAAATGCCTATTGGATC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    946 TATTTACCAAGCATTGGAGGAATATCGTAGGTAAAAATGCCTATTGGATC

    250     .    :    .    :    .    :    .    :    .    :
    243 CAAAGAGAGGCCAACATTTTTTGAAATTTTTAAGACACGCTGCAACAAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    996 CAAAGAGAGGCCAACATTTTTTGAAATTTTTAAGACACGCTGCAACAAAG

    300     .    :    .    :    .    :    .    :    .    :
    293 CAG         ATTTAGGACCAATAAGTCTTAATTGGTTTGAAGAACTT
        |||>>>...>>>||||||||||||||||||||||||||||||||||||||
   1046 CAGGTA...TAGATTTAGGACCAATAAGTCTTAATTGGTTTGAAGAACTT

    350     .    :    .    :    .    :    .    :    .    :
    334 TCTTCAGAAGCTCCACCCTATAATTCTGAACCTGCAGAAGAATCTGAACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   3636 TCTTCAGAAGCTCCACCCTATAATTCTGAACCTGCAGAAGAATCTGAACA

    400     .    :    .    :    .    :    .    :    .    :
    384 TAAAAACAACAATTACGAACCAAACCTATTTAAAACTCCACAAAGGAAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   3686 TAAAAACAACAATTACGAACCAAACCTATTTAAAACTCCACAAAGGAAAC

    450     .    :    .    :    .    :    .    :    .    :
    434 CATCTTATAATCAGCTGGCTTCAACTCCAATAATATTCAAAGAGCAAGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   3736 CATCTTATAATCAGCTGGCTTCAACTCCAATAATATTCAAAGAGCAAGGG

    500     .    :    .    :    .    :    .    :    .    :
    484 CTGACTCTGCCGCTGTACCAATCTCCTGTAAAAGAATTAGATAAATTCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   3786 CTGACTCTGCCGCTGTACCAATCTCCTGTAAAAGAATTAGATAAATTCAA

    550     .    :    .    :    .    :    .    :    .    :
    534 ATTAGACTTAG         GAAGGAATGTTCCCAATAGTAGACATAAAA
        |||||||||||>>>...>>>||||||||||||||||||||||||||||||
   3836 ATTAGACTTAGGTA...CAGGAAGGAATGTTCCCAATAGTAGACATAAAA

    600     .    :    .    :    .    :    .    :    .    :
    575 GTCTTCGCACAGTGAAAACTAAAATGGATCAAGCAGATGATGTTTCCTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   9627 GTCTTCGCACAGTGAAAACTAAAATGGATCAAGCAGATGATGTTTCCTGT

    650     .    :    .    :    .    :    .    :    .    :
    625 CCACTTCTAAATTCTTGTCTTAGTGAAAG         TCCTGTTGTTCT
        |||||||||||||||||||||||||||||>>>...>>>||||||||||||
   9677 CCACTTCTAAATTCTTGTCTTAGTGAAAGGTA...TAGTCCTGTTGTTCT

    700     .    :    .    :    .    :    .    :    .    :
    666 ACAATGTACACATGTAACACCACAAAGAGATAAGTCAG         TGG
        ||||||||||||||||||||||||||||||||||||||>>>...>>>|||
  10634 ACAATGTACACATGTAACACCACAAAGAGATAAGTCAGGTA...CAGTGG

    750     .    :    .    :    .    :    .    :    .    :
    707 TATGTGGGAGTTTGTTTCATACACCAAAGTTTGTGAAG         GGT
        ||||||||||||||||||||||||||||||||||||||>>>...>>>|||
  10766 TATGTGGGAGTTTGTTTCATACACCAAAGTTTGTGAAGGTA...CAGGGT

    800     .    :    .    :    .    :    .    :    .    :
    748 CGTCAGACACCAAAACATATTTCTGAAAGTCTAGGAGCTGAGGTGGATCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  11023 CGTCAGACACCAAAACATATTTCTGAAAGTCTAGGAGCTGAGGTGGATCC

    850     .    :    .    :    .    :    .    :    .    :
    798 TGATATGTCTTGGTCAAGTTCTTTAGCTACACCACCCACCCTTAGTTCTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  11073 TGATATGTCTTGGTCAAGTTCTTTAGCTACACCACCCACCCTTAGTTCTA

    900     .    :    .    :    .    :    .    :    .    :
    848 CTGTGCTCATAG         TCAGAAATGAAGAAGCATCTGAAACTGTA
        ||||||||||||>>>...>>>|||||||||||||||||||||||||||||
  11123 CTGTGCTCATAGGTA...CAGTCAGAAATGAAGAAGCATCTGAAACTGTA

    950     .    :    .    :    .    :    .    :    .    :
    889 TTTCCTCATGATACTACTGCT         AATGTGAAAAGCTATTTTTC
        |||||||||||||||||||||>>>...>>>||||||||||||||||||||
  13993 TTTCCTCATGATACTACTGCTGTA...CAGAATGTGAAAAGCTATTTTTC

   1000     .    :    .    :    .    :    .    :    .    :
    930 CAATCATGATGAAAGTCTGAAGAAAAATGATAGATTTATCGCTTCTGTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  15460 CAATCATGATGAAAGTCTGAAGAAAAATGATAGATTTATCGCTTCTGTGA

   1050     .    :    .    :    .    :    .    :    .    :
    980 CAGACAGTGAAAACACAAATCAAAGAGAAGCTGCAAGTCATG        
        ||||||||||||||||||||||||||||||||||||||||||>>>...>>
  15510 CAGACAGTGAAAACACAAATCAAAGAGAAGCTGCAAGTCATGGTA...CA

   1100     .    :    .    :    .    :    .    :    .    :
   1022  GATTTGGAAAAACATCAGGGAATTCATTTAAAGTAAATAGCTGCAAAGA
        >|||||||||||||||||||||||||||||||||||||||||||||||||
  16792 GGATTTGGAAAAACATCAGGGAATTCATTTAAAGTAAATAGCTGCAAAGA

   1150     .    :    .    :    .    :    .    :    .    :
   1071 CCACATTGGAAAGTCAATGCCAAATGTCCTAGAAGATGAAGTATATGAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  16842 CCACATTGGAAAGTCAATGCCAAATGTCCTAGAAGATGAAGTATATGAAA

   1200     .    :    .    :    .    :    .    :    .    :
   1121 CAGTTGTAGATACCTCTGAAGAAGATAGTTTTTCATTATGTTTTTCTAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  16892 CAGTTGTAGATACCTCTGAAGAAGATAGTTTTTCATTATGTTTTTCTAAA

   1250     .    :    .    :    .    :    .    :    .    :
   1171 TGTAGAACAAAAAATCTACAAAAAGTAAGAACTAGCAAGACTAGGAAAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  16942 TGTAGAACAAAAAATCTACAAAAAGTAAGAACTAGCAAGACTAGGAAAAA

   1300     .    :    .    :    .    :    .    :    .    :
   1221 AATTTTCCATGAAGCAAACGCTGATGAATGTGAAAAATCTAAAAACCAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  16992 AATTTTCCATGAAGCAAACGCTGATGAATGTGAAAAATCTAAAAACCAAG

   1350     .    :    .    :    .    :    .    :    .    :
   1271 TGAAAGAAAAATACTCATTTGTATCTGAAGTGGAACCAAATGATACTGAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  17042 TGAAAGAAAAATACTCATTTGTATCTGAAGTGGAACCAAATGATACTGAT

   1400     .    :    .    :    .    :    .    :    .    :
   1321 CCATTAGATTCAAATGTAGCACATCAGAAGCCCTTTGAGAGTGGAAGTGA
        ||||||||||||||||||||| ||||||||||||||||||||||||||||
  17092 CCATTAGATTCAAATGTAGCAAATCAGAAGCCCTTTGAGAGTGGAAGTGA

   1450     .    :    .    :    .    :    .    :    .    :
   1371 CAAAATCTCCAAGGAAGTTGTACCGTCTTTGGCCTGTGAATGGTCTCAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  17142 CAAAATCTCCAAGGAAGTTGTACCGTCTTTGGCCTGTGAATGGTCTCAAC

   1500     .    :    .    :    .    :    .    :    .    :
   1421 TAACCCTTTCAGGTCTAAATGGAGCCCAGATGGAGAAAATACCCCTATTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  17192 TAACCCTTTCAGGTCTAAATGGAGCCCAGATGGAGAAAATACCCCTATTG

   1550     .    :    .    :    .    :    .    :    .    :
   1471 CATATTTCTTCATGTGACCAAAATATTTCAGAAAAAGACCTATTAGACAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  17242 CATATTTCTTCATGTGACCAAAATATTTCAGAAAAAGACCTATTAGACAC

   1600     .    :    .    :    .    :    .    :    .    :
   1521 AGAGAACAAAAGAAAGAAAGATTTTCTTACTTCAGAGAATTCTTTGCCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  17292 AGAGAACAAAAGAAAGAAAGATTTTCTTACTTCAGAGAATTCTTTGCCAC

   1650     .    :    .    :    .    :    .    :    .    :
   1571 GTATTTCTAGCCTACCAAAATCAGAGAAGCCATTAAATGAGGAAACAGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  17342 GTATTTCTAGCCTACCAAAATCAGAGAAGCCATTAAATGAGGAAACAGTG

   1700     .    :    .    :    .    :    .    :    .    :
   1621 GTAAATAAGAGAGATGAAGAGCAGCATCTTGAATCTCATACAGACTGCAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  17392 GTAAATAAGAGAGATGAAGAGCAGCATCTTGAATCTCATACAGACTGCAT

   1750     .    :    .    :    .    :    .    :    .    :
   1671 TCTTGCAGTAAAGCAGGCAATATCTGGAACTTCTCCAGTGGCTTCTTCAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  17442 TCTTGCAGTAAAGCAGGCAATATCTGGAACTTCTCCAGTGGCTTCTTCAT

   1800     .    :    .    :    .    :    .    :    .    :
   1721 TTCAGGGTATCAAAAAGTCTATATTCAGAATAAGAGAATCACCTAAAGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  17492 TTCAGGGTATCAAAAAGTCTATATTCAGAATAAGAGAATCACCTAAAGAG

   1850     .    :    .    :    .    :    .    :    .    :
   1771 ACTTTCAATGCAAGTTTTTCAGGTCATATGACTGATCCAAACTTTAAAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  17542 ACTTTCAATGCAAGTTTTTCAGGTCATATGACTGATCCAAACTTTAAAAA

   1900     .    :    .    :    .    :    .    :    .    :
   1821 AGAAACTGAAGCCTCTGAAAGTGGACTGGAAATACATACTGTTTGCTCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  17592 AGAAACTGAAGCCTCTGAAAGTGGACTGGAAATACATACTGTTTGCTCAC

   1950     .    :    .    :    .    :    .    :    .    :
   1871 AGAAGGAGGACTCCTTATGTCCAAATTTAATTGATAATGGAAGCTGGCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  17642 AGAAGGAGGACTCCTTATGTCCAAATTTAATTGATAATGGAAGCTGGCCA

   2000     .    :    .    :    .    :    .    :    .    :
   1921 GCCACCACCACACAGAATTCTGTAGCTTTGAAGAATGCAGGTTTAATATC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  17692 GCCACCACCACACAGAATTCTGTAGCTTTGAAGAATGCAGGTTTAATATC

   2050     .    :    .    :    .    :    .    :    .    :
   1971 CACTTTGAAAAAGAAAACAAATAAGTTTATTTATGCTATACATGATGAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  17742 CACTTTGAAAAAGAAAACAAATAAGTTTATTTATGCTATACATGATGAAA

   2100     .    :    .    :    .    :    .    :    .    :
   2021 CATTTTATAAAGGAAAAAAAATACCGAAAGACCAAAAATCAGAACTAATT
        ||| ||||||||||||||||||||||||||||||||||||||||||||||
  17792 CATCTTATAAAGGAAAAAAAATACCGAAAGACCAAAAATCAGAACTAATT

   2150     .    :    .    :    .    :    .    :    .    :
   2071 AACTGTTCAGCCCAGTTTGAAGCAAATGCTTTTGAAGCACCACTTACATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  17842 AACTGTTCAGCCCAGTTTGAAGCAAATGCTTTTGAAGCACCACTTACATT

   2200     .    :    .    :    .    :    .    :    .    :
   2121 TGCAAATGCTGATTCAG         GTTTATTGCATTCTTCTGTGAAAA
        |||||||||||||||||>>>...>>>||||||||||||||||||||||||
  17892 TGCAAATGCTGATTCAGGTA...TAGGTTTATTGCATTCTTCTGTGAAAA

   2250     .    :    .    :    .    :    .    :    .    :
   2162 GAAGCTGTTCACAGAATGATTCTGAAGAACCAACTTTGTCCTTAACTAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  20810 GAAGCTGTTCACAGAATGATTCTGAAGAACCAACTTTGTCCTTAACTAGC

   2300     .    :    .    :    .    :    .    :    .    :
   2212 TCTTTTGGGACAATTCTGAGGAAATGTTCTAGAAATGAAACATGTTCTAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  20860 TCTTTTGGGACAATTCTGAGGAAATGTTCTAGAAATGAAACATGTTCTAA

   2350     .    :    .    :    .    :    .    :    .    :
   2262 TAATACAGTAATCTCTCAGGATCTTGATTATAAAGAAGCAAAATGTAATA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  20910 TAATACAGTAATCTCTCAGGATCTTGATTATAAAGAAGCAAAATGTAATA

   2400     .    :    .    :    .    :    .    :    .    :
   2312 AGGAAAAACTACAGTTATTTATTACCCCAGAAGCTGATTCTCTGTCATGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  20960 AGGAAAAACTACAGTTATTTATTACCCCAGAAGCTGATTCTCTGTCATGC

   2450     .    :    .    :    .    :    .    :    .    :
   2362 CTGCAGGAAGGACAGTGTGAAAATGATCCAAAAAGCAAAAAAGTTTCAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  21010 CTGCAGGAAGGACAGTGTGAAAATGATCCAAAAAGCAAAAAAGTTTCAGA

   2500     .    :    .    :    .    :    .    :    .    :
   2412 TATAAAAGAAGAGGTCTTGGCTGCAGCATGTCACCCAGTACAACATTCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  21060 TATAAAAGAAGAGGTCTTGGCTGCAGCATGTCACCCAGTACAACATTCAA

   2550     .    :    .    :    .    :    .    :    .    :
   2462 AAGTGGAATACAGTGATACTGACTTTCAATCCCAGAAAAGTCTTTTATAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  21110 AAGTGGAATACAGTGATACTGACTTTCAATCCCAGAAAAGTCTTTTATAT

   2600     .    :    .    :    .    :    .    :    .    :
   2512 GATCATGAAAATGCCAGCACTCTTATTTTAACTCCTACTTCCAAGGATGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  21160 GATCATGAAAATGCCAGCACTCTTATTTTAACTCCTACTTCCAAGGATGT

   2650     .    :    .    :    .    :    .    :    .    :
   2562 TCTGTCAAACCTAGTCATGATTTCTAGAGGCAAAGAATCATACAAAATGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  21210 TCTGTCAAACCTAGTCATGATTTCTAGAGGCAAAGAATCATACAAAATGT

   2700     .    :    .    :    .    :    .    :    .    :
   2612 CAGACAAGCTCAAAGGTAACAATTATGAATCTGATGTTGAATTAACCAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  21260 CAGACAAGCTCAAAGGTAACAATTATGAATCTGATGTTGAATTAACCAAA

   2750     .    :    .    :    .    :    .    :    .    :
   2662 AATATTCCCATGGAAAAGAATCAAGATGTATGTGCTTTAAATGAAAATTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  21310 AATATTCCCATGGAAAAGAATCAAGATGTATGTGCTTTAAATGAAAATTA

   2800     .    :    .    :    .    :    .    :    .    :
   2712 TAAAAACGTTGAGCTGTTGCCACCTGAAAAATACATGAGAGTAGCATCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  21360 TAAAAACGTTGAGCTGTTGCCACCTGAAAAATACATGAGAGTAGCATCAC

   2850     .    :    .    :    .    :    .    :    .    :
   2762 CTTCAAGAAAGGTACAATTCAACCAAAACACAAATCTAAGAGTAATCCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  21410 CTTCAAGAAAGGTACAATTCAACCAAAACACAAATCTAAGAGTAATCCAA

   2900     .    :    .    :    .    :    .    :    .    :
   2812 AAAAATCAAGAAGAAACTACTTCAATTTCAAAAATAACTGTCAATCCAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  21460 AAAAATCAAGAAGAAACTACTTCAATTTCAAAAATAACTGTCAATCCAGA

   2950     .    :    .    :    .    :    .    :    .    :
   2862 CTCTGAAGAACTTTTCTCAGACAATGAGAATAATTTTGTCTTCCAAGTAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  21510 CTCTGAAGAACTTTTCTCAGACAATGAGAATAATTTTGTCTTCCAAGTAG

   3000     .    :    .    :    .    :    .    :    .    :
   2912 CTAATGAAAGGAATAATCTTGCTTTAGGAAATACTAAGGAACTTCATGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  21560 CTAATGAAAGGAATAATCTTGCTTTAGGAAATACTAAGGAACTTCATGAA

   3050     .    :    .    :    .    :    .    :    .    :
   2962 ACAGACTTGACTTGTGTAAACGAACCCATTTTCAAGAACTCTACCATGGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  21610 ACAGACTTGACTTGTGTAAACGAACCCATTTTCAAGAACTCTACCATGGT

   3100     .    :    .    :    .    :    .    :    .    :
   3012 TTTATATGGAGACACAGGTGATAAACAAGCAACCCAAGTGTCAATTAAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  21660 TTTATATGGAGACACAGGTGATAAACAAGCAACCCAAGTGTCAATTAAAA

   3150     .    :    .    :    .    :    .    :    .    :
   3062 AAGATTTGGTTTATGTTCTTGCAGAGGAGAACAAAAATAGTGTAAAGCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  21710 AAGATTTGGTTTATGTTCTTGCAGAGGAGAACAAAAATAGTGTAAAGCAG

   3200     .    :    .    :    .    :    .    :    .    :
   3112 CATATAAAAATGACTCTAGGTCAAGATTTAAAATCGGACATCTCCTTGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  21760 CATATAAAAATGACTCTAGGTCAAGATTTAAAATCGGACATCTCCTTGAA

   3250     .    :    .    :    .    :    .    :    .    :
   3162 TATAGATAAAATACCAGAAAAAAATAATGATTACATGAACAAATGGGCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  21810 TATAGATAAAATACCAGAAAAAAATAATGATTACATGAACAAATGGGCAG

   3300     .    :    .    :    .    :    .    :    .    :
   3212 GACTCTTAGGTCCAATTTCAAATCACAGTTTTGGAGGTAGCTTCAGAACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  21860 GACTCTTAGGTCCAATTTCAAATCACAGTTTTGGAGGTAGCTTCAGAACA

   3350     .    :    .    :    .    :    .    :    .    :
   3262 GCTTCAAATAAGGAAATCAAGCTCTCTGAACATAACATTAAGAAGAGCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  21910 GCTTCAAATAAGGAAATCAAGCTCTCTGAACATAACATTAAGAAGAGCAA

   3400     .    :    .    :    .    :    .    :    .    :
   3312 AATGTTCTTCAAAGATATTGAAGAACAATATCCTACTAGTTTAGCTTGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  21960 AATGTTCTTCAAAGATATTGAAGAACAATATCCTACTAGTTTAGCTTGTG

   3450     .    :    .    :    .    :    .    :    .    :
   3362 TTGAAATTGTAAATACCTTGGCATTAGATAATCAAAAGAAACTGAGCAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  22010 TTGAAATTGTAAATACCTTGGCATTAGATAATCAAAAGAAACTGAGCAAG

   3500     .    :    .    :    .    :    .    :    .    :
   3412 CCTCAGTCAATTAATACTGTATCTGCACATTTACAGAGTAGTGTAGTTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  22060 CCTCAGTCAATTAATACTGTATCTGCACATTTACAGAGTAGTGTAGTTGT

   3550     .    :    .    :    .    :    .    :    .    :
   3462 TTCTGATTGTAAAAATAGTCATATAACCCCTCAGATGTTATTTTCCAAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  22110 TTCTGATTGTAAAAATAGTCATATAACCCCTCAGATGTTATTTTCCAAGC

   3600     .    :    .    :    .    :    .    :    .    :
   3512 AGGATTTTAATTCAAACCATAATTTAACACCTAGCCAAAAGGCAGAAATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  22160 AGGATTTTAATTCAAACCATAATTTAACACCTAGCCAAAAGGCAGAAATT

   3650     .    :    .    :    .    :    .    :    .    :
   3562 ACAGAACTTTCTACTATATTAGAAGAATCAGGAAGTCAGTTTGAATTTAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  22210 ACAGAACTTTCTACTATATTAGAAGAATCAGGAAGTCAGTTTGAATTTAC

   3700     .    :    .    :    .    :    .    :    .    :
   3612 TCAGTTTAGAAAACCAAGCTACATATTGCAGAAGAGTACATTTGAAGTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  22260 TCAGTTTAGAAAACCAAGCTACATATTGCAGAAGAGTACATTTGAAGTGC

   3750     .    :    .    :    .    :    .    :    .    :
   3662 CTGAAAACCAGATGACTATCTTAAAGACCACTTCTGAGGAATGCAGAGAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  22310 CTGAAAACCAGATGACTATCTTAAAGACCACTTCTGAGGAATGCAGAGAT

   3800     .    :    .    :    .    :    .    :    .    :
   3712 GCTGATCTTCATGTCATAATGAATGCCCCATCGATTGGTCAGGTAGACAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  22360 GCTGATCTTCATGTCATAATGAATGCCCCATCGATTGGTCAGGTAGACAG

   3850     .    :    .    :    .    :    .    :    .    :
   3762 CAGCAAGCAATTTGAAGGTACAGTTGAAATTAAACGGAAGTTTGCTGGCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  22410 CAGCAAGCAATTTGAAGGTACAGTTGAAATTAAACGGAAGTTTGCTGGCC

   3900     .    :    .    :    .    :    .    :    .    :
   3812 TGTTGAAAAATGACTGTAACAAAAGTGCTTCTGGTTATTTAACAGATGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  22460 TGTTGAAAAATGACTGTAACAAAAGTGCTTCTGGTTATTTAACAGATGAA

   3950     .    :    .    :    .    :    .    :    .    :
   3862 AATGAAGTGGGGTTTAGGGGCTTTTATTCTGCTCATGGCACAAAACTGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  22510 AATGAAGTGGGGTTTAGGGGCTTTTATTCTGCTCATGGCACAAAACTGAA

   4000     .    :    .    :    .    :    .    :    .    :
   3912 TGTTTCTACTGAAGCTCTGCAAAAAGCTGTGAAACTGTTTAGTGATATTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  22560 TGTTTCTACTGAAGCTCTGCAAAAAGCTGTGAAACTGTTTAGTGATATTG

   4050     .    :    .    :    .    :    .    :    .    :
   3962 AGAATATTAGTGAGGAAACTTCTGCAGAGGTACATCCAATAAGTTTATCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  22610 AGAATATTAGTGAGGAAACTTCTGCAGAGGTACATCCAATAAGTTTATCT

   4100     .    :    .    :    .    :    .    :    .    :
   4012 TCAAGTAAATGTCATGATTCTGTTGTTTCAATGTTTAAGATAGAAAATCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  22660 TCAAGTAAATGTCATGATTCTGTTGTTTCAATGTTTAAGATAGAAAATCA

   4150     .    :    .    :    .    :    .    :    .    :
   4062 TAATGATAAAACTGTAAGTGAAAAAAATAATAAATGCCAACTGATATTAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  22710 TAATGATAAAACTGTAAGTGAAAAAAATAATAAATGCCAACTGATATTAC

   4200     .    :    .    :    .    :    .    :    .    :
   4112 AAAATAATATTGAAATGACTACTGGCACTTTTGTTGAAGAAATTACTGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  22760 AAAATAATATTGAAATGACTACTGGCACTTTTGTTGAAGAAATTACTGAA

   4250     .    :    .    :    .    :    .    :    .    :
   4162 AATTACAAGAGAAATACTGAAAATGAAGATAACAAATATACTGCTGCCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  22810 AATTACAAGAGAAATACTGAAAATGAAGATAACAAATATACTGCTGCCAG

   4300     .    :    .    :    .    :    .    :    .    :
   4212 TAGAAATTCTCATAACTTAGAATTTGATGGCAGTGATTCAAGTAAAAATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  22860 TAGAAATTCTCATAACTTAGAATTTGATGGCAGTGATTCAAGTAAAAATG

   4350     .    :    .    :    .    :    .    :    .    :
   4262 ATACTGTTTGTATTCATAAAGATGAAACGGACTTGCTATTTACTGATCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  22910 ATACTGTTTGTATTCATAAAGATGAAACGGACTTGCTATTTACTGATCAG

   4400     .    :    .    :    .    :    .    :    .    :
   4312 CACAACATATGTCTTAAATTATCTGGCCAGTTTATGAAGGAGGGAAACAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  22960 CACAACATATGTCTTAAATTATCTGGCCAGTTTATGAAGGAGGGAAACAC

   4450     .    :    .    :    .    :    .    :    .    :
   4362 TCAGATTAAAGAAGATTTGTCAGATTTAACTTTTTTGGAAGTTGCGAAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  23010 TCAGATTAAAGAAGATTTGTCAGATTTAACTTTTTTGGAAGTTGCGAAAG

   4500     .    :    .    :    .    :    .    :    .    :
   4412 CTCAAGAAGCATGTCATGGTAATACTTCAAATAAAGAACAGTTAACTGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  23060 CTCAAGAAGCATGTCATGGTAATACTTCAAATAAAGAACAGTTAACTGCT

   4550     .    :    .    :    .    :    .    :    .    :
   4462 ACTAAAACGGAGCAAAATATAAAAGATTTTGAGACTTCTGATACATTTTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  23110 ACTAAAACGGAGCAAAATATAAAAGATTTTGAGACTTCTGATACATTTTT

   4600     .    :    .    :    .    :    .    :    .    :
   4512 TCAGACTGCAAGTGGGAAAAATATTAGTGTCGCCAAAGAGTCATTTAATA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  23160 TCAGACTGCAAGTGGGAAAAATATTAGTGTCGCCAAAGAGTCATTTAATA

   4650     .    :    .    :    .    :    .    :    .    :
   4562 AAATTGTAAATTTCTTTGATCAGAAACCAGAAGAATTGCATAACTTTTCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  23210 AAATTGTAAATTTCTTTGATCAGAAACCAGAAGAATTGCATAACTTTTCC

   4700     .    :    .    :    .    :    .    :    .    :
   4612 TTAAATTCTGAATTACATTCTGACATAAGAAAGAACAAAATGGACATTCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  23260 TTAAATTCTGAATTACATTCTGACATAAGAAAGAACAAAATGGACATTCT

   4750     .    :    .    :    .    :    .    :    .    :
   4662 AAGTTATGAGGAAACAGACATAGTTAAACACAAAATACTGAAAGAAAGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  23310 AAGTTATGAGGAAACAGACATAGTTAAACACAAAATACTGAAAGAAAGTG

   4800     .    :    .    :    .    :    .    :    .    :
   4712 TCCCAGTTGGTACTGGAAATCAACTAGTGACCTTCCAGGGACAACCCGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  23360 TCCCAGTTGGTACTGGAAATCAACTAGTGACCTTCCAGGGACAACCCGAA

   4850     .    :    .    :    .    :    .    :    .    :
   4762 CGTGATGAAAAGATCAAAGAACCTACTCTGTTGGGTTTTCATACAGCTAG
        ||||||||||||||||||||||||||||| ||||||||||||||||||||
  23410 CGTGATGAAAAGATCAAAGAACCTACTCTATTGGGTTTTCATACAGCTAG

   4900     .    :    .    :    .    :    .    :    .    :
   4812 CGGGAAAAAAGTTAAAATTGCAAAGGAATCTTTGGACAAAGTGAAAAACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  23460 CGGGAAAAAAGTTAAAATTGCAAAGGAATCTTTGGACAAAGTGAAAAACC

   4950     .    :    .    :    .    :    .    :    .    :
   4862 TTTTTGATGAAAAAGAGCAAGGTACTAGTGAAATCACCAGTTTTAGCCAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  23510 TTTTTGATGAAAAAGAGCAAGGTACTAGTGAAATCACCAGTTTTAGCCAT

   5000     .    :    .    :    .    :    .    :    .    :
   4912 CAATGGGCAAAGACCCTAAAGTACAGAGAGGCCTGTAAAGACCTTGAATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  23560 CAATGGGCAAAGACCCTAAAGTACAGAGAGGCCTGTAAAGACCTTGAATT

   5050     .    :    .    :    .    :    .    :    .    :
   4962 AGCATGTGAGACCATTGAGATCACAGCTGCCCCAAAGTGTAAAGAAATGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  23610 AGCATGTGAGACCATTGAGATCACAGCTGCCCCAAAGTGTAAAGAAATGC

   5100     .    :    .    :    .    :    .    :    .    :
   5012 AGAATTCTCTCAATAATGATAAAAACCTTGTTTCTATTGAGACTGTGGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  23660 AGAATTCTCTCAATAATGATAAAAACCTTGTTTCTATTGAGACTGTGGTG

   5150     .    :    .    :    .    :    .    :    .    :
   5062 CCACCTAAGCTCTTAAGTGATAATTTATGTAGACAAACTGAAAATCTCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  23710 CCACCTAAGCTCTTAAGTGATAATTTATGTAGACAAACTGAAAATCTCAA

   5200     .    :    .    :    .    :    .    :    .    :
   5112 AACATCAAAAAGTATCTTTTTGAAAGTTAAAGTACATGAAAATGTAGAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  23760 AACATCAAAAAGTATCTTTTTGAAAGTTAAAGTACATGAAAATGTAGAAA

   5250     .    :    .    :    .    :    .    :    .    :
   5162 AAGAAACAGCAAAAAGTCCTGCAACTTGTTACACAAATCAGTCCCCTTAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  23810 AAGAAACAGCAAAAAGTCCTGCAACTTGTTACACAAATCAGTCCCCTTAT

   5300     .    :    .    :    .    :    .    :    .    :
   5212 TCAGTCATTGAAAATTCAGCCTTAGCTTTTTACACAAGTTGTAGTAGAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  23860 TCAGTCATTGAAAATTCAGCCTTAGCTTTTTACACAAGTTGTAGTAGAAA

   5350     .    :    .    :    .    :    .    :    .    :
   5262 AACTTCTGTGAGTCAGACTTCATTACTTGAAGCAAAAAAATGGCTTAGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  23910 AACTTCTGTGAGTCAGACTTCATTACTTGAAGCAAAAAAATGGCTTAGAG

   5400     .    :    .    :    .    :    .    :    .    :
   5312 AAGGAATATTTGATGGTCAACCAGAAAGAATAAATACTGCAGATTATGTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  23960 AAGGAATATTTGATGGTCAACCAGAAAGAATAAATACTGCAGATTATGTA

   5450     .    :    .    :    .    :    .    :    .    :
   5362 GGAAATTATTTGTATGAAAATAATTCAAACAGTACTATAGCTGAAAATGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  24010 GGAAATTATTTGTATGAAAATAATTCAAACAGTACTATAGCTGAAAATGA

   5500     .    :    .    :    .    :    .    :    .    :
   5412 CAAAAATCATCTCTCCGAAAAACAAGATACTTATTTAAGTAACAGTAGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  24060 CAAAAATCATCTCTCCGAAAAACAAGATACTTATTTAAGTAACAGTAGCA

   5550     .    :    .    :    .    :    .    :    .    :
   5462 TGTCTAACAGCTATTCCTACCATTCTGATGAGGTATATAATGATTCAGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  24110 TGTCTAACAGCTATTCCTACCATTCTGATGAGGTATATAATGATTCAGGA

   5600     .    :    .    :    .    :    .    :    .    :
   5512 TATCTCTCAAAAAATAAACTTGATTCTGGTATTGAGCCAGTATTGAAGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  24160 TATCTCTCAAAAAATAAACTTGATTCTGGTATTGAGCCAGTATTGAAGAA

   5650     .    :    .    :    .    :    .    :    .    :
   5562 TGTTGAAGATCAAAAAAACACTAGTTTTTCCAAAGTAATATCCAATGTAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  24210 TGTTGAAGATCAAAAAAACACTAGTTTTTCCAAAGTAATATCCAATGTAA

   5700     .    :    .    :    .    :    .    :    .    :
   5612 AAGATGCAAATGCATACCCACAAACTGTAAATGAAGATATTTGCGTTGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  24260 AAGATGCAAATGCATACCCACAAACTGTAAATGAAGATATTTGCGTTGAG

   5750     .    :    .    :    .    :    .    :    .    :
   5662 GAACTTGTGACTAGCTCTTCACCCTGCAAAAATAAAAATGCAGCCATTAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  24310 GAACTTGTGACTAGCTCTTCACCCTGCAAAAATAAAAATGCAGCCATTAA

   5800     .    :    .    :    .    :    .    :    .    :
   5712 ATTGTCCATATCTAATAGTAATAATTTTGAGGTAGGGCCACCTGCATTTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  24360 ATTGTCCATATCTAATAGTAATAATTTTGAGGTAGGGCCACCTGCATTTA

   5850     .    :    .    :    .    :    .    :    .    :
   5762 GGATAGCCAGTGGTAAAATCGTTTGTGTTTCACATGAAACAATTAAAAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  24410 GGATAGCCAGTGGTAAAATCGTTTGTGTTTCACATGAAACAATTAAAAAA

   5900     .    :    .    :    .    :    .    :    .    :
   5812 GTGAAAGACATATTTACAGACAGTTTCAGTAAAGTAATTAAGGAAAACAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  24460 GTGAAAGACATATTTACAGACAGTTTCAGTAAAGTAATTAAGGAAAACAA

   5950     .    :    .    :    .    :    .    :    .    :
   5862 CGAGAATAAATCAAAAATTTGCCAAACGAAAATTATGGCAGGTTGTTACG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  24510 CGAGAATAAATCAAAAATTTGCCAAACGAAAATTATGGCAGGTTGTTACG

   6000     .    :    .    :    .    :    .    :    .    :
   5912 AGGCATTGGATGATTCAGAGGATATTCTTCATAACTCTCTAGATAATGAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  24560 AGGCATTGGATGATTCAGAGGATATTCTTCATAACTCTCTAGATAATGAT

   6050     .    :    .    :    .    :    .    :    .    :
   5962 GAATGTAGCACGCATTCACATAAGGTTTTTGCTGACATTCAGAGTGAAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  24610 GAATGTAGCACGCATTCACATAAGGTTTTTGCTGACATTCAGAGTGAAGA

   6100     .    :    .    :    .    :    .    :    .    :
   6012 AATTTTACAACATAACCAAAATATGTCTGGATTGGAGAAAGTTTCTAAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  24660 AATTTTACAACATAACCAAAATATGTCTGGATTGGAGAAAGTTTCTAAAA

   6150     .    :    .    :    .    :    .    :    .    :
   6062 TATCACCTTGTGATGTTAGTTTGGAAACTTCAGATATATGTAAATGTAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  24710 TATCACCTTGTGATGTTAGTTTGGAAACTTCAGATATATGTAAATGTAGT

   6200     .    :    .    :    .    :    .    :    .    :
   6112 ATAGGGAAGCTTCATAAGTCAGTCTCATCTGCAAATACTTGTGGGATTTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  24760 ATAGGGAAGCTTCATAAGTCAGTCTCATCTGCAAATACTTGTGGGATTTT

   6250     .    :    .    :    .    :    .    :    .    :
   6162 TAGCACAGCAAGTGGAAAATCTGTCCAGGTATCAGATGCTTCATTACAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  24810 TAGCACAGCAAGTGGAAAATCTGTCCAGGTATCAGATGCTTCATTACAAA

   6300     .    :    .    :    .    :    .    :    .    :
   6212 ACGCAAGACAAGTGTTTTCTGAAATAGAAGATAGTACCAAGCAAGTCTTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  24860 ACGCAAGACAAGTGTTTTCTGAAATAGAAGATAGTACCAAGCAAGTCTTT

   6350     .    :    .    :    .    :    .    :    .    :
   6262 TCCAAAGTATTGTTTAAAAGTAACGAACATTCAGACCAGCTCACAAGAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  24910 TCCAAAGTATTGTTTAAAAGTAACGAACATTCAGACCAGCTCACAAGAGA

   6400     .    :    .    :    .    :    .    :    .    :
   6312 AGAAAATACTGCTATACGTACTCCAGAACATTTAATATCCCAAAAAGGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  24960 AGAAAATACTGCTATACGTACTCCAGAACATTTAATATCCCAAAAAGGCT

   6450     .    :    .    :    .    :    .    :    .    :
   6362 TTTCATATAATGTGGTAAATTCATCTGCTTTCTCTGGATTTAGTACAGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  25010 TTTCATATAATGTGGTAAATTCATCTGCTTTCTCTGGATTTAGTACAGCA

   6500     .    :    .    :    .    :    .    :    .    :
   6412 AGTGGAAAGCAAGTTTCCATTTTAGAAAGTTCCTTACACAAAGTTAAGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  25060 AGTGGAAAGCAAGTTTCCATTTTAGAAAGTTCCTTACACAAAGTTAAGGG

   6550     .    :    .    :    .    :    .    :    .    :
   6462 AGTGTTAGAGGAATTTGATTTAATCAGAACTGAGCATAGTCTTCACTATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  25110 AGTGTTAGAGGAATTTGATTTAATCAGAACTGAGCATAGTCTTCACTATT

   6600     .    :    .    :    .    :    .    :    .    :
   6512 CACCTACGTCTAGACAAAATGTATCAAAAATACTTCCTCGTGTTGATAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  25160 CACCTACGTCTAGACAAAATGTATCAAAAATACTTCCTCGTGTTGATAAG

   6650     .    :    .    :    .    :    .    :    .    :
   6562 AGAAACCCAGAGCACTGTGTAAACTCAGAAATGGAAAAAACCTGCAGTAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  25210 AGAAACCCAGAGCACTGTGTAAACTCAGAAATGGAAAAAACCTGCAGTAA

   6700     .    :    .    :    .    :    .    :    .    :
   6612 AGAATTTAAATTATCAAATAACTTAAATGTTGAAGGTGGTTCTTCAGAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  25260 AGAATTTAAATTATCAAATAACTTAAATGTTGAAGGTGGTTCTTCAGAAA

   6750     .    :    .    :    .    :    .    :    .    :
   6662 ATAATCACTCTATTAAAGTTTCTCCATATCTCTCTCAATTTCAACAAGAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  25310 ATAATCACTCTATTAAAGTTTCTCCATATCTCTCTCAATTTCAACAAGAC

   6800     .    :    .    :    .    :    .    :    .    :
   6712 AAACAACAGTTGGTATTAGGAACCAAAGTCTCACTTGTTGAGAACATTCA
        ||||||||||||||||||||||||||||| ||||||||||||||||||||
  25360 AAACAACAGTTGGTATTAGGAACCAAAGTGTCACTTGTTGAGAACATTCA

   6850     .    :    .    :    .    :    .    :    .    :
   6762 TGTTTTGGGAAAAGAACAGGCTTCACCTAAAAACGTAAAAATGGAAATTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  25410 TGTTTTGGGAAAAGAACAGGCTTCACCTAAAAACGTAAAAATGGAAATTG

   6900     .    :    .    :    .    :    .    :    .    :
   6812 GTAAAACTGAAACTTTTTCTGATGTTCCTGTGAAAACAAATATAGAAGTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  25460 GTAAAACTGAAACTTTTTCTGATGTTCCTGTGAAAACAAATATAGAAGTT

   6950     .    :    .    :    .    :    .    :    .    :
   6862 TGTTCTACTTACTCCAAAGATTCAGAAAACTACTTTGAAACAGAAGCAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  25510 TGTTCTACTTACTCCAAAGATTCAGAAAACTACTTTGAAACAGAAGCAGT

   7000     .    :    .    :    .    :    .    :    .    :
   6912 AGAAATTGCTAAAGCTTTTATGGAAGATGATGAACTGACAGATTCTAAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  25560 AGAAATTGCTAAAGCTTTTATGGAAGATGATGAACTGACAGATTCTAAAC

   7050     .    :    .    :    .    :    .    :    .    :
   6962 TGCCAAGTCATGCCACACATTCTCTTTTTACATGTCCCGAAAATGAGGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  25610 TGCCAAGTCATGCCACACATTCTCTTTTTACATGTCCCGAAAATGAGGAA

   7100     .    :    .    :    .    :    .    :    .    :
   7012 ATGGTTTTGTCAAATTCAAGAATTGGAAAAAGAAGAGGAGAGCCCCTTAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  25660 ATGGTTTTGTCAAATTCAAGAATTGGAAAAAGAAGAGGAGAGCCCCTTAT

   7150     .    :    .    :    .    :    .    :    .    :
   7062 CTTAGTGG         GAGAACCCTCAATCAAAAGAAACTTATTAAATG
        ||||||||>>>...>>>|||||||||||||||||||||||||||||||||
  25710 CTTAGTGGGTA...TAGGAGAACCCTCAATCAAAAGAAACTTATTAAATG

   7200     .    :    .    :    .    :    .    :    .    :
   7103 AATTTGACAGGATAATAGAAAATCAAGAAAAATCCTTAAAGGCTTCAAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  29112 AATTTGACAGGATAATAGAAAATCAAGAAAAATCCTTAAAGGCTTCAAAA

   7250     .    :    .    :    .    :    .    :    .    :
   7153 AGCACTCCAGATG         GCACAATAAAAGATCGAAGATTGTTTAT
        |||||||||||||>>>...>>>||||||||||||||||||||||||||||
  29162 AGCACTCCAGATGGTA...TAGGCACAATAAAAGATCGAAGATTGTTTAT

   7300     .    :    .    :    .    :    .    :    .    :
   7194 GCATCATGTTTCTTTAGAGCCGATTACCTGTGTACCCTTTCG        
        ||||||||||||||||||||||||||||||||||||||||||>>>...>>
  31376 GCATCATGTTTCTTTAGAGCCGATTACCTGTGTACCCTTTCGGTA...CA

   7350     .    :    .    :    .    :    .    :    .    :
   7236  CACAACTAAGGAACGTCAAGAGATACAGAATCCAAATTTTACCGCACCT
        >|||||||||||||||||||||||||||||||||||||||||||||||||
  39381 GCACAACTAAGGAACGTCAAGAGATACAGAATCCAAATTTTACCGCACCT

   7400     .    :    .    :    .    :    .    :    .    :
   7285 GGTCAAGAATTTCTGTCTAAATCTCATTTGTATGAACATCTGACTTTGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  39431 GGTCAAGAATTTCTGTCTAAATCTCATTTGTATGAACATCTGACTTTGGA

   7450     .    :    .    :    .    :    .    :    .    :
   7335 AAAATCTTCAAGCAATTTAGCAGTTTCAGGACATCCATTTTATCAAGTTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  39481 AAAATCTTCAAGCAATTTAGCAGTTTCAGGACATCCATTTTATCAAGTTT

   7500     .    :    .    :    .    :    .    :    .    :
   7385 CTGCTACAAGAAATGAAAAAATGAGACACTTGATTACTACAGGCAGACCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  39531 CTGCTACAAGAAATGAAAAAATGAGACACTTGATTACTACAGGCAGACCA

   7550     .    :    .    :    .    :    .    :    .    :
   7435 ACCAAAGTCTTTGTTCCACCTTTTAAAACTAAATCACATTTTCACAGAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  39581 ACCAAAGTCTTTGTTCCACCTTTTAAAACTAAATCACATTTTCACAGAGT

   7600     .    :    .    :    .    :    .    :    .    :
   7485 TGAACAGTGTGTTAGGAATATTAACTTGGAGGAAAACAGACAAAAGCAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  39631 TGAACAGTGTGTTAGGAATATTAACTTGGAGGAAAACAGACAAAAGCAAA

   7650     .    :    .    :    .    :    .    :    .    :
   7535 ACATTGATGGACATGGCTCTGATGATAGTAAAAATAAGATTAATGACAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  39681 ACATTGATGGACATGGCTCTGATGATAGTAAAAATAAGATTAATGACAAT

   7700     .    :    .    :    .    :    .    :    .    :
   7585 GAGATTCATCAGTTTAACAAAAACAACTCCAATCAAGCAGCAGCTGTAAC
        |||||||||||||||||||||||||||||||||||||||| |||||||||
  39731 GAGATTCATCAGTTTAACAAAAACAACTCCAATCAAGCAGTAGCTGTAAC

   7750     .    :    .    :    .    :    .    :    .    :
   7635 TTTCACAAAGTGTGAAGAAGAACCTTTAG         ATTTAATTACAA
        |||||||||||||||||||||||||||||>>>...>>>||||||||||||
  39781 TTTCACAAAGTGTGAAGAAGAACCTTTAGGTA...TAGATTTAATTACAA

   7800     .    :    .    :    .    :    .    :    .    :
   7676 GTCTTCAGAATGCCAGAGATATACAGGATATGCGAATTAAGAAGAAACAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  40961 GTCTTCAGAATGCCAGAGATATACAGGATATGCGAATTAAGAAGAAACAA

   7850     .    :    .    :    .    :    .    :    .    :
   7726 AGGCAACGCGTCTTTCCACAGCCAGGCAGTCTGTATCTTGCAAAAACATC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  41011 AGGCAACGCGTCTTTCCACAGCCAGGCAGTCTGTATCTTGCAAAAACATC

   7900     .    :    .    :    .    :    .    :    .    :
   7776 CACTCTGCCTCGAATCTCTCTGAAAGCAGCAGTAGGAGGCCAAGTTCCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  41061 CACTCTGCCTCGAATCTCTCTGAAAGCAGCAGTAGGAGGCCAAGTTCCCT

   7950     .    :    .    :    .    :    .    :    .    :
   7826 CTGCGTGTTCTCATAAACAG         CTGTATACGTATGGCGTTTCT
        ||||||||||||||||||||>>>...>>>|||||||||||||||||||||
  41111 CTGCGTGTTCTCATAAACAGGTA...TAGCTGTATACGTATGGCGTTTCT

   8000     .    :    .    :    .    :    .    :    .    :
   7867 AAACATTGCATAAAAATTAACAGCAAAAATGCAGAGTCTTTTCAGTTTCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  42284 AAACATTGCATAAAAATTAACAGCAAAAATGCAGAGTCTTTTCAGTTTCA

   8050     .    :    .    :    .    :    .    :    .    :
   7917 CACTGAAGATTATTTTGGTAAGGAAAGTTTATGGACTGGAAAAGGAATAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  42334 CACTGAAGATTATTTTGGTAAGGAAAGTTTATGGACTGGAAAAGGAATAC

   8100     .    :    .    :    .    :    .    :    .    :
   7967 AGTTGGCTGATGGTGGATGGCTCATACCCTCCAATGATGGAAAGGCTGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  42384 AGTTGGCTGATGGTGGATGGCTCATACCCTCCAATGATGGAAAGGCTGGA

   8150     .    :    .    :    .    :    .    :    .    :
   8017 AAAGAAGAATTTTATAG         GGCTCTGTGTGACACTCCAGGTGT
        |||||||||||||||||>>>...>>>||||||||||||||||||||||||
  42434 AAAGAAGAATTTTATAGGTA...CAGGGCTCTGTGTGACACTCCAGGTGT

   8200     .    :    .    :    .    :    .    :    .    :
   8058 GGATCCAAAGCTTATTTCTAGAATTTGGGTTTATAATCACTATAGATGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  47068 GGATCCAAAGCTTATTTCTAGAATTTGGGTTTATAATCACTATAGATGGA

   8250     .    :    .    :    .    :    .    :    .    :
   8108 TCATATGGAAACTGGCAGCTATGGAATGTGCCTTTCCTAAGGAATTTGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  47118 TCATATGGAAACTGGCAGCTATGGAATGTGCCTTTCCTAAGGAATTTGCT

   8300     .    :    .    :    .    :    .    :    .    :
   8158 AATAGATGCCTAAGCCCAGAAAGGGTGCTTCTTCAACTAAAATACAG   
        |||||||||||||||||||||||||||||||||||||||||||||||>>>
  47168 AATAGATGCCTAAGCCCAGAAAGGGTGCTTCTTCAACTAAAATACAGGCA

   8350     .    :    .    :    .    :    .    :    .    :
   8205       ATATGATACGGAAATTGATAGAAGCAGAAGATCGGCTATAAAAA
        ...>>>||||||||||||||||||||||||||||||||||||||||||||
  47218 ...TAGATATGATACGGAAATTGATAGAAGCAGAAGATCGGCTATAAAAA

   8400     .    :    .    :    .    :    .    :    .    :
   8249 AGATAATGGAAAGGGATGACACAGCTGCAAAAACACTTGTTCTCTGTGTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  47744 AGATAATGGAAAGGGATGACACAGCTGCAAAAACACTTGTTCTCTGTGTT

   8450     .    :    .    :    .    :    .    :    .    :
   8299 TCTGACATAATTTCATTGAGCGCAAATATATCTGAAACTTCTAGCAATAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  47794 TCTGACATAATTTCATTGAGCGCAAATATATCTGAAACTTCTAGCAATAA

   8500     .    :    .    :    .    :    .    :    .    :
   8349 AACTAGTAGTGCAGATACCCAAAAAGTGGCCATTATTGAACTTACAGATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  47844 AACTAGTAGTGCAGATACCCAAAAAGTGGCCATTATTGAACTTACAGATG

   8550     .    :    .    :    .    :    .    :    .    :
   8399 GGTGGTATGCTGTTAAGGCCCAGTTAGATCCTCCCCTCTTAGCTGTCTTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  47894 GGTGGTATGCTGTTAAGGCCCAGTTAGATCCTCCCCTCTTAGCTGTCTTA

   8600     .    :    .    :    .    :    .    :    .    :
   8449 AAGAATGGCAGACTGACAGTTGGTCAGAAGATTATTCTTCATGGAGCAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  47944 AAGAATGGCAGACTGACAGTTGGTCAGAAGATTATTCTTCATGGAGCAGA

   8650     .    :    .    :    .    :    .    :    .    :
   8499 ACTGGTGGGCTCTCCTGATGCCTGTACACCTCTTGAAGCCCCAGAATCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  47994 ACTGGTGGGCTCTCCTGATGCCTGTACACCTCTTGAAGCCCCAGAATCTC

   8700     .    :    .    :    .    :    .    :    .    :
   8549 TTATGTTAAAG         ATTTCTGCTAACAGTACTCGGCCTGCTCGC
        |||||||||||>>>...>>>||||||||||||||||||||||||||||||
  48044 TTATGTTAAAGGTA...CAGATTTCTGCTAACAGTACTCGGCCTGCTCGC

   8750     .    :    .    :    .    :    .    :    .    :
   8590 TGGTATACCAAACTTGGATTCTTTCCTGACCCTAGACCTTTTCCTCTGCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54953 TGGTATACCAAACTTGGATTCTTTCCTGACCCTAGACCTTTTCCTCTGCC

   8800     .    :    .    :    .    :    .    :    .    :
   8640 CTTATCATCGCTTTTCAGTGATGGAGGAAATGTTGGTTGTGTTGATGTAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  55003 CTTATCATCGCTTTTCAGTGATGGAGGAAATGTTGGTTGTGTTGATGTAA

   8850     .    :    .    :    .    :    .    :    .    :
   8690 TTATTCAAAGAGCATACCCTATACAG         TGGATGGAGAAGACA
        ||||||||||||||||||||||||||>>>...>>>|||||||||||||||
  55053 TTATTCAAAGAGCATACCCTATACAGGTA...CAGTGGATGGAGAAGACA

   8900     .    :    .    :    .    :    .    :    .    :
   8731 TCATCTGGATTATACATATTTCGCAATGAAAGAGAGGAAGAAAAGGAAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  55492 TCATCTGGATTATACATATTTCGCAATGAAAGAGAGGAAGAAAAGGAAGC

   8950     .    :    .    :    .    :    .    :    .    :
   8781 AGCAAAATATGTGGAGGCCCAACAAAAGAGACTAGAAGCCTTATTCACTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  55542 AGCAAAATATGTGGAGGCCCAACAAAAGAGACTAGAAGCCTTATTCACTA

   9000     .    :    .    :    .    :    .    :    .    :
   8831 AAATTCAGGAGGAATTTGAAGAACATGAAG         AAAACACAACA
        ||||||||||||||||||||||||||||||>>>...>>>|||||||||||
  55592 AAATTCAGGAGGAATTTGAAGAACATGAAGGTA...TAGAAAACACAACA

   9050     .    :    .    :    .    :    .    :    .    :
   8872 AAACCATATTTACCATCACGTGCACTAACAAGACAGCAAGTTCGTGCTTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  61202 AAACCATATTTACCATCACGTGCACTAACAAGACAGCAAGTTCGTGCTTT

   9100     .    :    .    :    .    :    .    :    .    :
   8922 GCAAGATGGTGCAGAGCTTTATGAAGCAGTGAAGAATGCAGCAGACCCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  61252 GCAAGATGGTGCAGAGCTTTATGAAGCAGTGAAGAATGCAGCAGACCCAG

   9150     .    :    .    :    .    :    .    :    .    :
   8972 CTTACCTTGAG         GGTTATTTCAGTGAAGAGCAGTTAAGAGCC
        |||||||||||>>>...>>>||||||||||||||||||||||||||||||
  61302 CTTACCTTGAGGTG...CAGGGTTATTTCAGTGAAGAGCAGTTAAGAGCC

   9200     .    :    .    :    .    :    .    :    .    :
   9013 TTGAATAATCACAGGCAAATGTTGAATGATAAGAAACAAGCTCAGATCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  63868 TTGAATAATCACAGGCAAATGTTGAATGATAAGAAACAAGCTCAGATCCA

   9250     .    :    .    :    .    :    .    :    .    :
   9063 GTTGGAAATTAGGAAGGCCATGGAATCTGCTGAACAAAAGGAACAAGGTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  63918 GTTGGAAATTAGGAAGGCCATGGAATCTGCTGAACAAAAGGAACAAGGTT

   9300     .    :    .    :    .    :    .    :    .    :
   9113 TATCAAGGGATGTCACAACCGTGTGGAAGTTGCGTATTGTAAGCTATTCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  63968 TATCAAGGGATGTCACAACCGTGTGGAAGTTGCGTATTGTAAGCTATTCA

   9350     .    :    .    :    .    :    .    :    .    :
   9163 AAAAAAGAAAAAGATTCAG         TTATACTGAGTATTTGGCGTCC
        |||||||||||||||||||>>>...>>>||||||||||||||||||||||
  64018 AAAAAAGAAAAAGATTCAGGTA...CAGTTATACTGAGTATTTGGCGTCC

   9400     .    :    .    :    .    :    .    :    .    :
   9204 ATCATCAGATTTATATTCTCTGTTAACAGAAGGAAAGAGATACAGAATTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  64293 ATCATCAGATTTATATTCTCTGTTAACAGAAGGAAAGAGATACAGAATTT

   9450     .    :    .    :    .    :    .    :    .    :
   9254 ATCATCTTGCAACTTCAAAATCTAAAAGTAAATCTGAAAGAGCTAACATA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  64343 ATCATCTTGCAACTTCAAAATCTAAAAGTAAATCTGAAAGAGCTAACATA

   9500     .    :    .    :    .    :    .    :    .    :
   9304 CAGTTAGCAGCGACAAAAAAAACTCAGTATCAACAACTACCG        
        ||||||||||||||||||||||||||||||||||||||||||>>>...>>
  64393 CAGTTAGCAGCGACAAAAAAAACTCAGTATCAACAACTACCGGTA...TA

   9550     .    :    .    :    .    :    .    :    .    :
   9346  GTTTCAGATGAAATTTTATTTCAGATTTACCAGCCACGGGAGCCCCTTC
        >|||||||||||||||||||||||||||||||||||||||||||||||||
  64527 GGTTTCAGATGAAATTTTATTTCAGATTTACCAGCCACGGGAGCCCCTTC

   9600     .    :    .    :    .    :    .    :    .    :
   9395 ACTTCAGCAAATTTTTAGATCCAGACTTTCAGCCATCTTGTTCTGAGGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  64577 ACTTCAGCAAATTTTTAGATCCAGACTTTCAGCCATCTTGTTCTGAGGTG

   9650     .    :    .    :    .    :    .    :    .    :
   9445 GACCTAATAGGATTTGTCGTTTCTGTTGTGAAAAAAACAG         G
        ||||||||||||||||||||||||||||||||||||||||>>>...>>>|
  64627 GACCTAATAGGATTTGTCGTTTCTGTTGTGAAAAAAACAGGTA...TAGG

   9700     .    :    .    :    .    :    .    :    .    :
   9486 ACTTGCCCCTTTCGTCTATTTGTCAGACGAATGTTACAATTTACTGGCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79211 ACTTGCCCCTTTCGTCTATTTGTCAGACGAATGTTACAATTTACTGGCAA

   9750     .    :    .    :    .    :    .    :    .    :
   9536 TAAAGTTTTGGATAGACCTTAATGAGGACATTATTAAGCCTCATATGTTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79261 TAAAGTTTTGGATAGACCTTAATGAGGACATTATTAAGCCTCATATGTTA

   9800     .    :    .    :    .    :    .    :    .    :
   9586 ATTGCTGCAAGCAACCTCCAGTGGCGACCAGAATCCAAATCAGGCCTTCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79311 ATTGCTGCAAGCAACCTCCAGTGGCGACCAGAATCCAAATCAGGCCTTCT

   9850     .    :    .    :    .    :    .    :    .    :
   9636 TACTTTATTTGCTGGAGATTTTTCTGTGTTTTCTGCTAGTCCAAAAGAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79361 TACTTTATTTGCTGGAGATTTTTCTGTGTTTTCTGCTAGTCCAAAAGAGG

   9900     .    :    .    :    .    :    .    :    .    :
   9686 GCCACTTTCAAGAGACATTCAACAAAATGAAAAATACTGTTGAG      
        ||||||||||||||||||||||||||||||||||||||||||||>>>...
  79411 GCCACTTTCAAGAGACATTCAACAAAATGAAAAATACTGTTGAGGTA...

   9950     .    :    .    :    .    :    .    :    .    :
   9730    AATATTGACATACTTTGCAATGAAGCAGAAAACAAGCTTATGCATAT
        >>>|||||||||||||||||||||||||||||||||||||||||||||||
  81416 TAGAATATTGACATACTTTGCAATGAAGCAGAAAACAAGCTTATGCATAT

  10000     .    :    .    :    .    :    .    :    .    :
   9777 ACTGCATGCAAATGATCCCAAGTGGTCCACCCCAACTAAAGACTGTACTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  81466 ACTGCATGCAAATGATCCCAAGTGGTCCACCCCAACTAAAGACTGTACTT

  10050     .    :    .    :    .    :    .    :    .    :
   9827 CAGGGCCGTACACTGCTCAAATCATTCCTGGTACAGGAAACAAGCTTCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  81516 CAGGGCCGTACACTGCTCAAATCATTCCTGGTACAGGAAACAAGCTTCTG

  10100     .    :    .    :    .    :    .    :    .    :
   9877          ATGTCTTCTCCTAATTGTGAGATATATTATCAAAGTCCTTT
        >>>...>>>|||||||||||||||||||||||||||||||||||||||||
  81566 GTA...CAGATGTCTTCTCCTAATTGTGAGATATATTATCAAAGTCCTTT

  10150     .    :    .    :    .    :    .    :    .    :
   9918 ATCACTTTGTATGGCCAAAAGGAAGTCTGTTTCCACACCTGTCTCAGCCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  82724 ATCACTTTGTATGGCCAAAAGGAAGTCTGTTTCCACACCTGTCTCAGCCC

  10200     .    :    .    :    .    :    .    :    .    :
   9968 AGATGACTTCAAAGTCTTGTAAAGGGGAGAAAGAGATTGATGACCAAAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  82774 AGATGACTTCAAAGTCTTGTAAAGGGGAGAAAGAGATTGATGACCAAAAG

  10250     .    :    .    :    .    :    .    :    .    :
  10018 AACTGCAAAAAGAGAAGAGCCTTGGATTTCTTGAGTAGACTGCCTTTACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  82824 AACTGCAAAAAGAGAAGAGCCTTGGATTTCTTGAGTAGACTGCCTTTACC

  10300     .    :    .    :    .    :    .    :    .    :
  10068 TCCACCTGTTAGTCCCATTTGTACATTTGTTTCTCCGGCTGCACAGAAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  82874 TCCACCTGTTAGTCCCATTTGTACATTTGTTTCTCCGGCTGCACAGAAGG

  10350     .    :    .    :    .    :    .    :    .    :
  10118 CATTTCAGCCACCAAGGAGTTGTGGCACCAAATACGAAACACCCATAAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  82924 CATTTCAGCCACCAAGGAGTTGTGGCACCAAATACGAAACACCCATAAAG

  10400     .    :    .    :    .    :    .    :    .    :
  10168 AAAAAAGAACTGAATTCTCCTCAGATGACTCCATTTAAAAAATTCAATGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  82974 AAAAAAGAACTGAATTCTCCTCAGATGACTCCATTTAAAAAATTCAATGA

  10450     .    :    .    :    .    :    .    :    .    :
  10218 AATTTCTCTTTTGGAAAGTAATTCAATAGCTGACGAAGAACTTGCATTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  83024 AATTTCTCTTTTGGAAAGTAATTCAATAGCTGACGAAGAACTTGCATTGA

  10500     .    :    .    :    .    :    .    :    .    :
  10268 TAAATACCCAAGCTCTTTTGTCTGGTTCAACAGGAGAAAAACAATTTATA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  83074 TAAATACCCAAGCTCTTTTGTCTGGTTCAACAGGAGAAAAACAATTTATA

  10550     .    :    .    :    .    :    .    :    .    :
  10318 TCTGTCAGTGAATCCACTAGGACTGCTCCCACCAGTTCAGAAGATTATCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  83124 TCTGTCAGTGAATCCACTAGGACTGCTCCCACCAGTTCAGAAGATTATCT

  10600     .    :    .    :    .    :    .    :    .    :
  10368 CAGACTGAAACGACGTTGTACTACATCTCTGATCAAAGAACAGGAGAGTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  83174 CAGACTGAAACGACGTTGTACTACATCTCTGATCAAAGAACAGGAGAGTT

  10650     .    :    .    :    .    :    .    :    .    :
  10418 CCCAGGCCAGTACGGAAGAATGTGAGAAAAATAAGCAGGACACAATTACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  83224 CCCAGGCCAGTACGGAAGAATGTGAGAAAAATAAGCAGGACACAATTACA

  10700     .    :    .    :    .    :    .    :    .    :
  10468 ACTAAAAAATATATCTAAGCATTTGCAAAGGCGACAATAAATTATTGACG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  83274 ACTAAAAAATATATCTAAGCATTTGCAAAGGCGACAATAAATTATTGACG

  10750     .    :    .    :    .    :    .    :    .    :
  10518 CTTAACCTTTCCAGTTTATAAGACTGGAATATAATTTCAAACCACACATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  83324 CTTAACCTTTCCAGTTTATAAGACTGGAATATAATTTCAAACCACACATT

  10800     .    :    .    :    .    :    .    :    .    :
  10568 AGTACTTATGTTGCACAATGAGAAAAGAAATTAGTTTCAAATTTACCTCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  83374 AGTACTTATGTTGCACAATGAGAAAAGAAATTAGTTTCAAATTTACCTCA

  10850     .    :    .    :    .    :    .    :    .    :
  10618 GCGTTTGTGTATCGGGCAAAAATCGTTTTGCCCGATTCCGTATTGGTATA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  83424 GCGTTTGTGTATCGGGCAAAAATCGTTTTGCCCGATTCCGTATTGGTATA

  10900     .    :    .    :    .    :    .    :    .    :
  10668 CTTTTGCTTCAGTTGCATATCTTAAAACTAAATGTAATTTATTAACTAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  83474 CTTTTGCTTCAGTTGCATATCTTAAAACTAAATGTAATTTATTAACTAAT

  10950     .    :    .    :    .    :    .    :    .    :
  10718 CAAGAAAAACATCTTTGGCTGAGCTCGGTGGCTCATGCCTGTAATCCCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  83524 CAAGAAAAACATCTTTGGCTGAGCTCGGTGGCTCATGCCTGTAATCCCAA

  11000     .    :    .    :    .    :    .    :    .    :
  10768 CACTTTGAGAAGCTGAGGTGGGAGGAGTGCTTGAGGCCAGGAGTTCAAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  83574 CACTTTGAGAAGCTGAGGTGGGAGGAGTGCTTGAGGCCAGGAGTTCAAGA

  11050     .    :    .    :    .    :    .    :    .    :
  10818 CCAGCCTGGGCAACATAGGGAGACCCCCATCTTTACGAAGAAAAAAAAAA
        |||||||||||||||||||||||||||||||||||| |||||||||||||
  83624 CCAGCCTGGGCAACATAGGGAGACCCCCATCTTTACAAAGAAAAAAAAAA

  11100     .    :    .    :    .    :    .    :    .    :
  10868 AGGGGAAAAGAAAATCTTTTAAATCTTTGGATTTGATCACTACAAGTATT
        -|||||||||||||||||||||||||||||||||||||||||||||||||
  83674  GGGGAAAAGAAAATCTTTTAAATCTTTGGATTTGATCACTACAAGTATT

  11150     .    :    .    :    .    :    .    :    .    :
  10918 ATTTTACAA         TCAACAAAATGGTCATCCAAACTCAAACTTGA
        |||||||||>>>...>>>||||||||||||||||||||||||||||||||
  83723 ATTTTACAAGTG...TTTTCAACAAAATGGTCATCCAAACTCAAACTTGA

  11200     .    :    .    :    .
  10959 GAAAATATCTTGCTTTCAAATTGACACT
        ||||||||||||||||||||||| ||||
  84162 GAAAATATCTTGCTTTCAAATTGGCACT

END