Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: H90415.1
Subject Sequence ID: ENSG00000012048
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/H90415.1, 391 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000012048 (ENSG00000012048), 81091 bp

>gi|1080845|gb|H90415.1|H90415 yv01e06.s1 Soares fetal liver spleen 1NFLS Homo sapiens cDNA clone IMAGE:241474 3', mRNA sequence
>ENSG00000012048

1-391  (22-411)   98%

      0     .    :    .    :    .    :    .    :    .    :
      1 GCAGTGTTAACAGCACAACATTTACAAAACGTATTTTGTACAATCAAGTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     22 GCAGTGTTAACAGCACAACATTTACAAAACGTATTTTGTACAATCAAGTC

     50     .    :    .    :    .    :    .    :    .    :
     51 TTCACTGCCCTTGCACACTAGGGGGGCTAGGGAAGACCTAGTCCTTCCAA
        ||||||||||||||||||| ||||||||||||||||||||||||||||||
     72 TTCACTGCCCTTGCACACTGGGGGGGCTAGGGAAGACCTAGTCCTTCCAA

    100     .    :    .    :    .    :    .    :    .    :
    101 CAGCTATAAACAGTCCTGGATAATGGGTTTATGAAAAACACTTTTTCTTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    122 CAGCTATAAACAGTCCTGGATAATGGGTTTATGAAAAACACTTTTTCTTC

    150     .    :    .    :    .    :    .    :    .    :
    151 CTTCAGCAAGCAAAATTATTTATGAAGCTGTATGGTTTCAGCAACAGGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    172 CTTCAGCAAGCAAAATTATTTATGAAGCTGTATGGTTTCAGCAACAGGGA

    200     .    :    .    :    .    :    .    :    .    :
    201 GCAAAGGAAAAAAATCACCTCAAAGAAAGCAACAGCTTCCTTCCTGGTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    222 GCAAAGGAAAAAAATCACCTCAAAGAAAGCAACAGCTTCCTTCCTGGTGG

    250     .    :    .    :    .    :    .    :    .    :
    251 GATCTGTCATTTTATAGATATGAAATATTCATGCCAGAGGTCTTATATTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    272 GATCTGTCATTTTATAGATATGAAATATTCATGCCAGAGGTCTTATATTT

    300     .    :    .    :    .    :    .    :    .    :
    301 TAAGAGGAATGGATTATATACCAGAGCTACAACAANAAACATTTTACNTA
        ||||||||||||||||||||||||||||||||||| ||||||||||| ||
    322 TAAGAGGAATGGATTATATACCAGAGCTACAACAATAAACATTTTACTTA

    350     .    :    .    :    .    :    .    :
    351 TTAGCTAATGAGGAATTAGAAGACGGTCTTNGGAAACCGTT
        |||-|||||||||||||||||||| ||||| |||||||| |
    372 TTA CTAATGAGGAATTAGAAGACTGTCTTTGGAAACCGGT

END