Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: H14053.1
Subject Sequence ID: ENSG00000141837
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/H14053.1, 235 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000141837 (ENSG00000141837), 298924 bp

>gi|878901|gb|H14053.1|H14053 ym65d10.r1 Soares adult brain N2b4HB55Y Homo sapiens cDNA clone IMAGE:163795 5' similar to SP:CCB1_RABIT P27883 BRAIN CALCIUM CHANNEL BI-1 ;, mRNA sequence
>ENSG00000141837

(complement)

1-163  (274353-274515)   95% ->
164-235  (276016-276086)   94%

      0     .    :    .    :    .    :    .    :    .    :
      1 GCTTCTCTTCCGGAGTGCCACCNGGGAAGCTTGGCACAACATCATGCTTT
         | | || || ||||||||||| |||||||||||||||||||||||||||
 274353 CCCTGTCCTCAGGAGTGCCACCGGGGAAGCTTGGCACAACATCATGCTTT

     50     .    :    .    :    .    :    .    :    .    :
     51 CCTGCCTCAGCGGGAAACCGTGTGATAAGAACTCTGGCATCCTGACTCGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 274403 CCTGCCTCAGCGGGAAACCGTGTGATAAGAACTCTGGCATCCTGACTCGA

    100     .    :    .    :    .    :    .    :    .    :
    101 GAGTGTGGCAATGAATTTGCTTATTTTTACTTTGTTTCCTTCATCTTNCT
        ||||||||||||||||||||||||||||||||||||||||||||||| ||
 274453 GAGTGTGGCAATGAATTTGCTTATTTTTACTTTGTTTCCTTCATCTTCCT

    150     .    :    .    :    .    :    .    :    .    :
    151 CTGCTCGTTTCTG         ATGCTGAATCTCTTTGTCGCCGTCATCA
        |||||||||||||>>>...>>>||||||||||||||||||||||||||||
 274503 CTGCTCGTTTCTGGTG...CAGATGCTGAATCTCTTTGTCGCCGTCATCA

    200     .    :    .    :    .    :    .    :
    192 TGGACAACTTTGAGTACCTNACCCGAGACTCCTNCATCCNGGGG
        ||||||||||||||||||| ||||||||||||| ||||| |||-
 276044 TGGACAACTTTGAGTACCTCACCCGAGACTCCTCCATCCTGGG 

END