Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: CN276644.1
Subject Sequence ID: ENSG00000141837
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/CN276644.1, 144 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000141837 (ENSG00000141837), 298924 bp

>gi|47293058|gb|CN276644.1|CN276644 17000600110927 GRN_PREHEP Homo sapiens cDNA 5', mRNA sequence
>ENSG00000141837

(complement)

1-115  (253120-253234)   98% ->
116-144  (260960-260988)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 GAAGTTCTATGGGGCTTCTGTTGCTTATGAAAATGCCCTGCGGGTGTTCA
          ||||||||||||||||||||||||||||||||||||||||||||||||
 253120 CTAGTTCTATGGGGCTTCTGTTGCTTATGAAAATGCCCTGCGGGTGTTCA

     50     .    :    .    :    .    :    .    :    .    :
     51 ACATCGTCTTCACCTCCCTCTTCTCTCTGGAATGTGTGCTGAAAGTCATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 253170 ACATCGTCTTCACCTCCCTCTTCTCTCTGGAATGTGTGCTGAAAGTCATG

    100     .    :    .    :    .    :    .    :    .    :
    101 GCTTTTGGGATTCTG         AATTATTTCCGCGATGCCTGGAACAT
        |||||||||||||||>>>...>>>||||||||||||||||||||||||||
 253220 GCTTTTGGGATTCTGGTA...TAGAATTATTTCCGCGATGCCTGGAACAT

    150 
    142 CTT
        |||
 260986 CTT

END