Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: CF138586.1
Subject Sequence ID: ENSG00000012048
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/CF138586.1, 457 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000012048 (ENSG00000012048), 81091 bp

>gi|33254030|gb|CF138586.1|CF138586 UI-HF-BN0-anw-d-01-0-UI.r1 NIH_MGC_50 Homo sapiens cDNA clone IMAGE:3094272 5', mRNA sequence
>ENSG00000012048

11-457  (1-447)   100%

      0     .    :    .    :    .    :    .    :    .    :
     11 TGTTTGCTACCAAGTTTATTTGCAGTGTTAACAGCACAACATTTACAAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      1 TGTTTGCTACCAAGTTTATTTGCAGTGTTAACAGCACAACATTTACAAAA

     50     .    :    .    :    .    :    .    :    .    :
     61 CGTATTTTGTACAATCAAGTCTTCACTGCCCTTGCACACTGGGGGGGCTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     51 CGTATTTTGTACAATCAAGTCTTCACTGCCCTTGCACACTGGGGGGGCTA

    100     .    :    .    :    .    :    .    :    .    :
    111 GGGAAGACCTAGTCCTTCCAACAGCTATAAACAGTCCTGGATAATGGGTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    101 GGGAAGACCTAGTCCTTCCAACAGCTATAAACAGTCCTGGATAATGGGTT

    150     .    :    .    :    .    :    .    :    .    :
    161 TATGAAAAACACTTTTTCTTCCTTCAGCAAGCAAAATTATTTATGAAGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    151 TATGAAAAACACTTTTTCTTCCTTCAGCAAGCAAAATTATTTATGAAGCT

    200     .    :    .    :    .    :    .    :    .    :
    211 GTATGGTTTCAGCAACAGGGAGCAAAGGAAAAAAATCACCTCAAAGAAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    201 GTATGGTTTCAGCAACAGGGAGCAAAGGAAAAAAATCACCTCAAAGAAAG

    250     .    :    .    :    .    :    .    :    .    :
    261 CAACAGCTTCCTTCCTGGTGGGATCTGTCATTTTATAGATATGAAATATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    251 CAACAGCTTCCTTCCTGGTGGGATCTGTCATTTTATAGATATGAAATATT

    300     .    :    .    :    .    :    .    :    .    :
    311 CATGCCAGAGGTCTTATATTTTAAGAGGAATGGATTATATACCAGAGCTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    301 CATGCCAGAGGTCTTATATTTTAAGAGGAATGGATTATATACCAGAGCTA

    350     .    :    .    :    .    :    .    :    .    :
    361 CAACAATAAACATTTTACTTATTACTAATGAGGAATTAGAAGACTGTCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    351 CAACAATAAACATTTTACTTATTACTAATGAGGAATTAGAAGACTGTCTT

    400     .    :    .    :    .    :    .    :    .
    411 TGGAAACCGGTTCTTGAAAATCTTCTGCTGTTTTAGAACACATTCTT
        |||||||||||||||||||||||||||||||||||||||||||||||
    401 TGGAAACCGGTTCTTGAAAATCTTCTGCTGTTTTAGAACACATTCTT

END