Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: CA774694.1
Subject Sequence ID: ENSG00000141837
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/CA774694.1, 659 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000141837 (ENSG00000141837), 298924 bp

>gi|26012167|gb|CA774694.1|CA774694 ip10f09.x1 HR85 islet Homo sapiens cDNA clone IMAGE:6216712 3' similar to SW:CCAA_RABIT P27884 VOLTAGE-DEPENDENT P/Q-TYPE CALCIUM CHANNEL ALPHA-1A SUBUNIT ;, mRNA sequence
>ENSG00000141837

1-19  (164461-164479)   100% <-
20-159  (245576-245715)   100% <-
160-242  (247807-247889)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 CCCAACTGTCGCCAAGATG         CCCGTTAGCACCACCACAAAGT
        |||||||||||||||||||<<<...<<<||||||||||||||||||||||
 164461 CCCAACTGTCGCCAAGATGCTG...TACCCCGTTAGCACCACCACAAAGT

     50     .    :    .    :    .    :    .    :    .    :
     42 CCATGACATTCCAGCCATTCCTCAAGTAGGAGCCTTTGTGGAAGGCAAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 245598 CCATGACATTCCAGCCATTCCTCAAGTAGGAGCCTTTGTGGAAGGCAAAC

    100     .    :    .    :    .    :    .    :    .    :
     92 CCAAGGGCAATGATTTTAATTCCAGCCTCGAAACAAAAAATTCCAATGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 245648 CCAAGGGCAATGATTTTAATTCCAGCCTCGAAACAAAAAATTCCAATGAA

    150     .    :    .    :    .    :    .    :    .    :
    142 GTATGGTTCTGTGTCATC         CAGCCGTTCAGACATCGGGGTCT
        ||||||||||||||||||<<<...<<<|||||||||||||||||||||||
 245698 GTATGGTTCTGTGTCATCCTG...CACCAGCCGTTCAGACATCGGGGTCT

    200     .    :    .    :    .    :    .    :    .    :
    183 TGTCATCATCAGGCAGATGCTGCTCCAGTGCGAGGACGATGCAATTCGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 247830 TGTCATCATCAGGCAGATGCTGCTCCAGTGCGAGGACGATGCAATTCGCT

    250     .    :
    233 ATGATGGTGG
        ||||||||||
 247880 ATGATGGTGG

END