Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BU677011.1
Subject Sequence ID: ENSG00000012048
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BU677011.1, 620 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000012048 (ENSG00000012048), 81091 bp

>gi|23522549|gb|BU677011.1|BU677011 UI-CF-DU1-aan-o-07-0-UI.s1 UI-CF-DU1 Homo sapiens cDNA clone UI-CF-DU1-aan-o-07-0-UI 3', mRNA sequence
>ENSG00000012048

(complement)

1-21  (78617-78637)   90% ==
55-620  (80495-81060)   99%

      0     .    :    .    :
      1 TTTTTTTTTTTTTTTTTTGAG
          |||||||||||||||||||
  78617 CCTTTTTTTTTTTTTTTTGAG

      0     .    :    .    :    .    :    .    :    .    :
     55 CGGGAGGTGGAGGTTGCAGTGAGCCAAGATCATACCACGGCACTCCAGCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80495 CGGGAGGTGGAGGTTGCAGTGAGCCAAGATCATACCACGGCACTCCAGCC

     50     .    :    .    :    .    :    .    :    .    :
    105 TGGGTGACAGTGAGACTGTGGCTCAAAAAAAAAAAAAAAAAAAGGAAAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80545 TGGGTGACAGTGAGACTGTGGCTCAAAAAAAAAAAAAAAAAAAGGAAAAT

    100     .    :    .    :    .    :    .    :    .    :
    155 GAAACTAGAAGAGATTTCTAAAAGTCTGAAATATATTTGCTAAATTTCTA
        ||||||||||||||||||||||||||||| |||||||||||| |||||||
  80595 GAAACTAGAAGAGATTTCTAAAAGTCTGAGATATATTTGCTAGATTTCTA

    150     .    :    .    :    .    :    .    :    .    :
    205 AAGAATGTGTTCTAAAACAGCAGAAGATTTTCAAGAACCGGTTTCCAAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80645 AAGAATGTGTTCTAAAACAGCAGAAGATTTTCAAGAACCGGTTTCCAAAG

    200     .    :    .    :    .    :    .    :    .    :
    255 ACAGTCTTCTAATTCCTCATTAGTAATAAGTAAAATGTTTATTGTTGTAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80695 ACAGTCTTCTAATTCCTCATTAGTAATAAGTAAAATGTTTATTGTTGTAG

    250     .    :    .    :    .    :    .    :    .    :
    305 CTCTGGTATATAATCCATTCCTCTTAAAATATAAGACCTCTGGCATGAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80745 CTCTGGTATATAATCCATTCCTCTTAAAATATAAGACCTCTGGCATGAAT

    300     .    :    .    :    .    :    .    :    .    :
    355 ATTTCATATCTATAAAATGACAGATCCCACCAGGAAGGAAGCTGTTGCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80795 ATTTCATATCTATAAAATGACAGATCCCACCAGGAAGGAAGCTGTTGCTT

    350     .    :    .    :    .    :    .    :    .    :
    405 TCTTTGAGGTGATTTTTTTCCTTTGCTCCCTGTTGCTGAAACCATACAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80845 TCTTTGAGGTGATTTTTTTCCTTTGCTCCCTGTTGCTGAAACCATACAGC

    400     .    :    .    :    .    :    .    :    .    :
    455 TTCATAAATAATTTTGCTTGCTGAAGGAAAAAAAAGTGTTTTTCATAAAC
        ||||||||||||||||||||||||||||| ||||||||||||||||||||
  80895 TTCATAAATAATTTTGCTTGCTGAAGGAAGAAAAAGTGTTTTTCATAAAC

    450     .    :    .    :    .    :    .    :    .    :
    505 CCATTATCCAGGACTGTTTATAGCTGTTGGAAGGACTAGGTCTTCCCTAA
        ||||||||||||||||||||||||||||||||||||||||||||||||| 
  80945 CCATTATCCAGGACTGTTTATAGCTGTTGGAAGGACTAGGTCTTCCCTAG

    500     .    :    .    :    .    :    .    :    .    :
    555 CCCCCCCAGTGTGCAAGGGCAGTGAAGACTTGATTGTACAAAATACGTTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80995 CCCCCCCAGTGTGCAAGGGCAGTGAAGACTTGATTGTACAAAATACGTTT

    550     .    :    .
    605 TGTAAATGTTGTGCTG
        ||||||||||||||||
  81045 TGTAAATGTTGTGCTG

END