Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BU617173.1
Subject Sequence ID: ENSG00000012048
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BU617173.1, 702 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000012048 (ENSG00000012048), 81091 bp

>gi|23283388|gb|BU617173.1|BU617173 UI-H-DF0-beo-j-12-0-UI.s1 NCI_CGAP_DF0 Homo sapiens cDNA clone UI-H-DF0-beo-j-12-0-UI 3', mRNA sequence
>ENSG00000012048

23-702  (1-681)   99%

      0     .    :    .    :    .    :    .    :    .    :
     23 TGTTTGCTACCAAGTTTATTTGCAGTGTTAACAGCACAACATTTACAAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      1 TGTTTGCTACCAAGTTTATTTGCAGTGTTAACAGCACAACATTTACAAAA

     50     .    :    .    :    .    :    .    :    .    :
     73 CGTATTTTGTACAATCAAGTCTTCACTGCCCTTGCACACTGGGGGGGCTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     51 CGTATTTTGTACAATCAAGTCTTCACTGCCCTTGCACACTGGGGGGGCTA

    100     .    :    .    :    .    :    .    :    .    :
    123 GGGAAGACCTAGTCCTTCCAACAGCTATAAACAGTCCTGGATAATGGGTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    101 GGGAAGACCTAGTCCTTCCAACAGCTATAAACAGTCCTGGATAATGGGTT

    150     .    :    .    :    .    :    .    :    .    :
    173 TATGAAAAACACTTTTTCTTCCTTCAGCAAGCAAAATTATTTATGAAGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    151 TATGAAAAACACTTTTTCTTCCTTCAGCAAGCAAAATTATTTATGAAGCT

    200     .    :    .    :    .    :    .    :    .    :
    223 GTATGGTTTCAGCAACAGGGAGCAAAGGAAAAAAATCACCTCAAAGAAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    201 GTATGGTTTCAGCAACAGGGAGCAAAGGAAAAAAATCACCTCAAAGAAAG

    250     .    :    .    :    .    :    .    :    .    :
    273 CAACAGCTTCCTTCCTGGTGGGATCTGTCATTTTATAGATATGAAATATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    251 CAACAGCTTCCTTCCTGGTGGGATCTGTCATTTTATAGATATGAAATATT

    300     .    :    .    :    .    :    .    :    .    :
    323 CATGCCAGAGGTCTTATATTTTAAGAGGAATGGATTATATACCAGAGCTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    301 CATGCCAGAGGTCTTATATTTTAAGAGGAATGGATTATATACCAGAGCTA

    350     .    :    .    :    .    :    .    :    .    :
    373 CAACAATAAACATTTTACTTATTACTAATGAGGAATTAGAAGACTGTCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    351 CAACAATAAACATTTTACTTATTACTAATGAGGAATTAGAAGACTGTCTT

    400     .    :    .    :    .    :    .    :    .    :
    423 TGGAAACCGGTTCTTGAAAATCTTCTGCTGTTTTAGAACACATTCTTTAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    401 TGGAAACCGGTTCTTGAAAATCTTCTGCTGTTTTAGAACACATTCTTTAG

    450     .    :    .    :    .    :    .    :    .    :
    473 AAATCTAGCAAATATATCTCAGACTTTTAGAAATCTCTTCTAGTTTCATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    451 AAATCTAGCAAATATATCTCAGACTTTTAGAAATCTCTTCTAGTTTCATT

    500     .    :    .    :    .    :    .    :    .    :
    523 TTCCTTTTTTTTTTTTTTTTTTTGAGCCACAGTCTCACTGTCACCCAGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    501 TTCCTTTTTTTTTTTTTTTTTTTGAGCCACAGTCTCACTGTCACCCAGGC

    550     .    :    .    :    .    :    .    :    .    :
    573 TGGAGTGCCGTGGTATGATCTTGGCTCACTGCAACCTCCACCTCCCGGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    551 TGGAGTGCCGTGGTATGATCTTGGCTCACTGCAACCTCCACCTCCCGGGC

    600     .    :    .    :    .    :    .    :    .    :
    623 TGAAGTGATTCTCCTGCCTTAGCCACCTGAGTAGCTGGGATTACAGGTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    601 TGAAGTGATTCTCCTGCCTTAGCCACCTGAGTAGCTGGGATTACAGGTGT

    650     .    :    .    :    .    :
    673 CCAC ACCATGACCGGCTAATTTCTGTATTT
        ||||-||||||||||||||||||||||||||
    651 CCACCACCATGACCGGCTAATTTCTGTATTT

END