Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BU552955.1
Subject Sequence ID: ENSG00000012048
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BU552955.1, 894 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000012048 (ENSG00000012048), 81091 bp

>gi|22903227|gb|BU552955.1|BU552955 AGENCOURT_10373395 NIH_MGC_109 Homo sapiens cDNA clone IMAGE:6576815 5', mRNA sequence
>ENSG00000012048

(complement)

1-59  (61459-61518)   98% ->
60-100  (62019-62059)   100% ->
101-184  (68257-68340)   100% ->
185-239  (74275-74329)   100% ->
240-313  (76198-76271)   100% ->
314-374  (77689-77749)   100% ->
375-894  (79590-80107)   96%

      0     .    :    .    :    .    :    .    :    .    :
      1 AACGGA ACTGAAATATTTTCTAGGAATTGCGGGAGGAAAATGGGTAGTT
        ||||||-|||||||||||||||||||||||||||||||||||||||||||
  61459 AACGGACACTGAAATATTTTCTAGGAATTGCGGGAGGAAAATGGGTAGTT

     50     .    :    .    :    .    :    .    :    .    :
     50 AGCTATTTCT         GGGTGACCCAGTCTATTAAAGAAAGAAAAAT
        ||||||||||>>>...>>>|||||||||||||||||||||||||||||||
  61509 AGCTATTTCTGTA...TAGGGGTGACCCAGTCTATTAAAGAAAGAAAAAT

    100     .    :    .    :    .    :    .    :    .    :
     91 GCTGAATGAG         CATGATTTTGAAGTCAGAGGAGATGTGGTCA
        ||||||||||>>>...>>>|||||||||||||||||||||||||||||||
  62050 GCTGAATGAGGTA...CAGCATGATTTTGAAGTCAGAGGAGATGTGGTCA

    150     .    :    .    :    .    :    .    :    .    :
    132 ATGGAAGAAACCACCAAGGTCCAAAGCGAGCAAGAGAATCCCAGGACAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  68288 ATGGAAGAAACCACCAAGGTCCAAAGCGAGCAAGAGAATCCCAGGACAGA

    200     .    :    .    :    .    :    .    :    .    :
    182 AAG         ATCTTCAGGGGGCTAGAAATCTGTTGCTATGGGCCCTT
        |||>>>...>>>||||||||||||||||||||||||||||||||||||||
  68338 AAGGTA...CAGATCTTCAGGGGGCTAGAAATCTGTTGCTATGGGCCCTT

    250     .    :    .    :    .    :    .    :    .    :
    223 CACCAACATGCCCACAG         ATCAACTGGAATGGATGGTACAGC
        |||||||||||||||||>>>...>>>||||||||||||||||||||||||
  74313 CACCAACATGCCCACAGGTA...TAGATCAACTGGAATGGATGGTACAGC

    300     .    :    .    :    .    :    .    :    .    :
    264 TGTGTGGTGCTTCTGTGGTGAAGGAGCTTTCATCATTCACCCTTGGCACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  76222 TGTGTGGTGCTTCTGTGGTGAAGGAGCTTTCATCATTCACCCTTGGCACA

    350     .    :    .    :    .    :    .    :    .    :
    314          GGTGTCCACCCAATTGTGGTTGTGCAGCCAGATGCCTGGAC
        >>>...>>>|||||||||||||||||||||||||||||||||||||||||
  76272 GTA...CAGGGTGTCCACCCAATTGTGGTTGTGCAGCCAGATGCCTGGAC

    400     .    :    .    :    .    :    .    :    .    :
    355 AGAGGACAATGGCTTCCATG         CAATTGGGCAGATGTGTGAGG
        ||||||||||||||||||||>>>...>>>|||||||||||||||||||||
  77730 AGAGGACAATGGCTTCCATGGTA...CAGCAATTGGGCAGATGTGTGAGG

    450     .    :    .    :    .    :    .    :    .    :
    396 CACCTGTGGTGACCCGAGAGTGGGTGTTGGACAGTGTAGCACTCTACCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79611 CACCTGTGGTGACCCGAGAGTGGGTGTTGGACAGTGTAGCACTCTACCAG

    500     .    :    .    :    .    :    .    :    .    :
    446 TGCCAGGAGCTGGACACCTACCTGATACCCCAGATCCCCCACAGCCACTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79661 TGCCAGGAGCTGGACACCTACCTGATACCCCAGATCCCCCACAGCCACTA

    550     .    :    .    :    .    :    .    :    .    :
    496 CTGACTGCAGCCAGCCACAGGTACAGAGCCACAGGACCCCAAGAATGAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79711 CTGACTGCAGCCAGCCACAGGTACAGAGCCACAGGACCCCAAGAATGAGC

    600     .    :    .    :    .    :    .    :    .    :
    546 TTACAAAGTGGCCTTTCCAGGCCCTGGGAGCTCCTCTCACTCTTCAGTCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79761 TTACAAAGTGGCCTTTCCAGGCCCTGGGAGCTCCTCTCACTCTTCAGTCC

    650     .    :    .    :    .    :    .    :    .    :
    596 TTCTACTGTCCTGGCTACTANATATTTTATGTACATCAGCCTGAAAAGGA
        |||||||||||||||||||| |||||||||||||||||||||||||||||
  79811 TTCTACTGTCCTGGCTACTAAATATTTTATGTACATCAGCCTGAAAAGGA

    700     .    :    .    :    .    :    .    :    .    :
    646 CTTCTGGCTATGCAAGGGTCCCTTANAGATTTTCTGCTTTGAGTCTCCCT
        ||||||||||||||||||||||||| |||||||||||||  |||||||||
  79861 CTTCTGGCTATGCAAGGGTCCCTTAAAGATTTTCTGCTTGAAGTCTCCCT

    750     .    :    .    :    .    :    .    :    .    :
    696 TGGAAATCTTGCCATGAGCACAAAATTATGGTAATTTTTCACCTGAGAAG
        |||||||||-||||||||||||||||||||||||||||||||||||||||
  79911 TGGAAATCT GCCATGAGCACAAAATTATGGTAATTTTTCACCTGAGAAG

    800     .    :    .    :    .    :    .    :    .    :
    746 ATTTTAANACCATTTTAAACGC ACCAATTGAGCAAGATGCTGATTCATT
        ||||||| ||||-|||||||||-|||||||||||||||||||||||||||
  79960 ATTTTAAAACCA TTTAAACGCCACCAATTGAGCAAGATGCTGATTCATT

    850     .    :    .    :    .    :    .    :    .    :
    795 ATTTATCAGCCCTATTCTTTCTATTCANGCTGNTGTTTGGCTAAGGGCTG
        ||||||||||||||||||||||||||| |||| ||||-|||| |||||||
  80009 ATTTATCAGCCCTATTCTTTCTATTCAGGCTGTTGTT GGCTTAGGGCTG

    900     .    :    .    :    .    :    .    :    .    :
    845 GGAAGCACAGAGTGGCTTGGCCTCAA AAAAAAGCTGGGTTCCCTAAGTT
        |-||||||||||||||||||||||||-| || |||||| |||||||||||
  80058 G AAGCACAGAGTGGCTTGGCCTCAAGAGAATAGCTGGTTTCCCTAAGTT

    950 
    894 T
        |
  80107 T

END