Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BQ936836.1
Subject Sequence ID: ENSG00000141837
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BQ936836.1, 478 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000141837 (ENSG00000141837), 298924 bp

>gi|22352219|gb|BQ936836.1|BQ936836 AGENCOURT_10017970 NIH_MGC_101 Homo sapiens cDNA clone IMAGE:6497139 5', mRNA sequence
>ENSG00000141837

(complement)

1-127  (298798-298924)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 CCGGCGACTCCCCAACGGCTACTACCCGGCGCACGGACTGGCCAGGCCCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298798 CCGGCGACTCCCCAACGGCTACTACCCGGCGCACGGACTGGCCAGGCCCC

     50     .    :    .    :    .    :    .    :    .    :
     51 GCGGGCCGGGCTCCAGGAAGGGCCTGCACGAACCCTACAGCGAGAGTGAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298848 GCGGGCCGGGCTCCAGGAAGGGCCTGCACGAACCCTACAGCGAGAGTGAC

    100     .    :    .    :    .
    101 GATGATTGGTGCTAAGCCCGGGCGAGG
        |||||||||||||||||||||||||||
 298898 GATGATTGGTGCTAAGCCCGGGCGAGG

END