Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BQ679749.1
Subject Sequence ID: ENSG00000012048
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BQ679749.1, 947 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000012048 (ENSG00000012048), 81091 bp

>gi|21792428|gb|BQ679749.1|BQ679749 AGENCOURT_8192481 NIH_MGC_112 Homo sapiens cDNA clone IMAGE:6261076 5', mRNA sequence
>ENSG00000012048

(complement)

25-100  (57709-57784)   100% ->
101-178  (61441-61518)   98% ->
179-219  (62019-62059)   100% ->
220-303  (68257-68340)   100% ->
304-358  (74275-74329)   92% ->
359-432  (76198-76271)   100% ->
433-493  (77689-77749)   100% ->
494-947  (79590-80041)   98%

      0     .    :    .    :    .    :    .    :    .    :
     25 AAGTTTGCCAGAAAACACCACATCACTTTAACTAATCTAATTACTGAAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  57709 AAGTTTGCCAGAAAACACCACATCACTTTAACTAATCTAATTACTGAAGA

     50     .    :    .    :    .    :    .    :    .    :
     75 GACTACTCATGTTGTTATGAAAACAG         ACGCTGAGTTTGTGT
        ||||||||||||||||||||||||||>>>...>>>| |||||||||||||
  57759 GACTACTCATGTTGTTATGAAAACAGGTA...CAGATGCTGAGTTTGTGT

    100     .    :    .    :    .    :    .    :    .    :
    116 GTGAACGGACACTGAAATATTTTCTAGGAATTGCGGGAGGAAAATGGGTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  61456 GTGAACGGACACTGAAATATTTTCTAGGAATTGCGGGAGGAAAATGGGTA

    150     .    :    .    :    .    :    .    :    .    :
    166 GTTAGCTATTTCT         GGGTGACCCAGTCTATTAAAGAAAGAAA
        |||||||||||||>>>...>>>||||||||||||||||||||||||||||
  61506 GTTAGCTATTTCTGTA...TAGGGGTGACCCAGTCTATTAAAGAAAGAAA

    200     .    :    .    :    .    :    .    :    .    :
    207 AATGCTGAATGAG         CATGATTTTGAAGTCAGAGGAGATGTGG
        |||||||||||||>>>...>>>||||||||||||||||||||||||||||
  62047 AATGCTGAATGAGGTA...CAGCATGATTTTGAAGTCAGAGGAGATGTGG

    250     .    :    .    :    .    :    .    :    .    :
    248 TCAATGGAAGAAACCACCAAGGTCCAAAGCGAGCAAGAGAATCCCAGGAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  68285 TCAATGGAAGAAACCACCAAGGTCCAAAGCGAGCAAGAGAATCCCAGGAC

    300     .    :    .    :    .    :    .    :    .    :
    298 AGAAAG         ATCTTCAGGGGGCTAGAAATCTGTTGCTATGGGCC
        ||||||>>>...>>>|||||||||||||||||||||||||||||||||||
  68335 AGAAAGGTA...CAGATCTTCAGGGGGCTAGAAATCTGTTGCTATGGGCC

    350     .    :    .    :    .    :    .    :    .    :
    339 CTTCTTCTTCATGCCCACAG         ATCAACTGGAATGGATGGTAC
        ||||  |  |||||||||||>>>...>>>|||||||||||||||||||||
  74310 CTTCACCAACATGCCCACAGGTA...TAGATCAACTGGAATGGATGGTAC

    400     .    :    .    :    .    :    .    :    .    :
    380 AGCTGTGTGGTGCTTCTGTGGTGAAGGAGCTTTCATCATTCACCCTTGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  76219 AGCTGTGTGGTGCTTCTGTGGTGAAGGAGCTTTCATCATTCACCCTTGGC

    450     .    :    .    :    .    :    .    :    .    :
    430 ACA         GGTGTCCACCCAATTGTGGTTGTGCAGCCAGATGCCTG
        |||>>>...>>>||||||||||||||||||||||||||||||||||||||
  76269 ACAGTA...CAGGGTGTCCACCCAATTGTGGTTGTGCAGCCAGATGCCTG

    500     .    :    .    :    .    :    .    :    .    :
    471 GACAGAGGACAATGGCTTCCATG         CAATTGGGCAGATGTGTG
        |||||||||||||||||||||||>>>...>>>||||||||||||||||||
  77727 GACAGAGGACAATGGCTTCCATGGTA...CAGCAATTGGGCAGATGTGTG

    550     .    :    .    :    .    :    .    :    .    :
    512 AGGCACCTGTGGTGACCCGAGAGTGGGTGTTGGACAGTGTAGCACTCTAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79608 AGGCACCTGTGGTGACCCGAGAGTGGGTGTTGGACAGTGTAGCACTCTAC

    600     .    :    .    :    .    :    .    :    .    :
    562 CAGTGCCAGGAGCTGGACACCTACCTGATACCCCAGATCCCCCACAGCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79658 CAGTGCCAGGAGCTGGACACCTACCTGATACCCCAGATCCCCCACAGCCA

    650     .    :    .    :    .    :    .    :    .    :
    612 CTACTGACTGCAGCCAGCCACAGGTACAGAGCCACAGGACCCCAAGAATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79708 CTACTGACTGCAGCCAGCCACAGGTACAGAGCCACAGGACCCCAAGAATG

    700     .    :    .    :    .    :    .    :    .    :
    662 AGCTTACAAAGTGGCCTTTCCAGGCCCTGGGAGCTCCTCTCACTCTTCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79758 AGCTTACAAAGTGGCCTTTCCAGGCCCTGGGAGCTCCTCTCACTCTTCAG

    750     .    :    .    :    .    :    .    :    .    :
    712 TCCTTCTACTGTCCTGGCTACTAAATATTTTATGTACATCAGCCTGAAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79808 TCCTTCTACTGTCCTGGCTACTAAATATTTTATGTACATCAGCCTGAAAA

    800     .    :    .    :    .    :    .    :    .    :
    762 GGACTTCTGGCTATGCAAGGGTCCCCTTAAGATTTTTCTGCTTGAAGTCT
        ||||||||||||||||||||||||| | ||||||||-|||||||||||||
  79858 GGACTTCTGGCTATGCAAGGGTCCCTTAAAGATTTT CTGCTTGAAGTCT

    850     .    :    .    :    .    :    .    :    .    :
    812 CCCTTGGAAATCTGCCATGAGCACAAAATAATGGGTAATTTTTCACCTGA
        ||||||||||||||||||||||||||||| ||||-|||||||||||||||
  79907 CCCTTGGAAATCTGCCATGAGCACAAAATTATGG TAATTTTTCACCTGA

    900     .    :    .    :    .    :    .    :    .    :
    862 GAAGATTTTAAAACCATTTAAACGCCACCAATTGAGCAAGATGCTGAATC
        ||||||||||||||||||||||||||||||||||||||||||||||| ||
  79956 GAAGATTTTAAAACCATTTAAACGCCACCAATTGAGCAAGATGCTGATTC

    950     .    :    .    :    .    :    .
    912 ATTATTTATCAGCCCCATTCTTTCTATTCAGGGTGT
        ||||||||||||||| |||||||||||||||| |||
  80006 ATTATTTATCAGCCCTATTCTTTCTATTCAGGCTGT

END