Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BQ340521.1
Subject Sequence ID: ENSG00000141837
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BQ340521.1, 552 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000141837 (ENSG00000141837), 298924 bp

>gi|21001433|gb|BQ340521.1|BQ340521 QV2-NN2003-110501-637-a02 NN2003 Homo sapiens cDNA, mRNA sequence
>ENSG00000141837

(complement)

1-60  (171788-171847)   98% ->
61-116  (173300-173356)   98% ->
117-212  (175886-175981)   100% ->
213-422  (188904-189113)   100% ->
423-552  (193444-193573)   98%

      0     .    :    .    :    .    :    .    :    .    :
      1 CGCGGCAACAACAGATTGAACGTGAGCTCAATGGGTACATGGAGTGGATC
         |||||||||||||||||||||||||||||||||||||||||||||||||
 171788 GGCGGCAACAACAGATTGAACGTGAGCTCAATGGGTACATGGAGTGGATC

     50     .    :    .    :    .    :    .    :    .    :
     51 TCAAAAGCAG         AAGAGGTGATCCTCGCCGAGGATGAAACTGA
        ||||||||||>>>...>>>|||||||||||||||||||||||||||||||
 171838 TCAAAAGCAGGTG...CAGAAGAGGTGATCCTCGCCGAGGATGAAACTGA

    100     .    :    .    :    .    :    .    :    .    :
     92 CGGGGAGCAGAGGCATCC TTTGATG         TTGGAGCTCTGCGGA
        ||||||||||||||||||-|||||||>>>...>>>|||||||||||||||
 173331 CGGGGAGCAGAGGCATCCCTTTGATGGTA...TTGTTGGAGCTCTGCGGA

    150     .    :    .    :    .    :    .    :    .    :
    132 GAACCACCATAAAGAAAAGCAAGACAGATTTGCTCAACCCCGAAGAGGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 175901 GAACCACCATAAAGAAAAGCAAGACAGATTTGCTCAACCCCGAAGAGGCT

    200     .    :    .    :    .    :    .    :    .    :
    182 GAGGATCAGCTGGCTGATATAGCCTCTGTGG         GTTCTCCCTT
        |||||||||||||||||||||||||||||||>>>...>>>||||||||||
 175951 GAGGATCAGCTGGCTGATATAGCCTCTGTGGGTG...CAGGTTCTCCCTT

    250     .    :    .    :    .    :    .    :    .    :
    223 CGCCCGAGCCAGCATTAAAAGTGCCAAGCTGGAGAACTCGACCTTTTTTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188914 CGCCCGAGCCAGCATTAAAAGTGCCAAGCTGGAGAACTCGACCTTTTTTC

    300     .    :    .    :    .    :    .    :    .    :
    273 ACAAAAAGGAGAGGAGGATGCGTTTCTACATCCGCCGCATGGTCAAAACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188964 ACAAAAAGGAGAGGAGGATGCGTTTCTACATCCGCCGCATGGTCAAAACT

    350     .    :    .    :    .    :    .    :    .    :
    323 CAGGCCTTCTACTGGACTGTACTCAGTTTGGTAGCTCTCAACACGCTGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 189014 CAGGCCTTCTACTGGACTGTACTCAGTTTGGTAGCTCTCAACACGCTGTG

    400     .    :    .    :    .    :    .    :    .    :
    373 TGTTGCTATTGTTCACTACAACCAGCCCGAGTGGCTCTCCGACTTCCTTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 189064 TGTTGCTATTGTTCACTACAACCAGCCCGAGTGGCTCTCCGACTTCCTTT

    450     .    :    .    :    .    :    .    :    .    :
    423          ACTATGCAGAATTCATTTTCTTAGGACTCTTTATGTCCGAA
        >>>...>>>|||||||||||||||||||||||||||||||||||||||||
 189114 GTG...TAGACTATGCAGAATTCATTTTCTTAGGACTCTTTATGTCCGAA

    500     .    :    .    :    .    :    .    :    .    :
    464 ATGTTTATAAAAATGTACGGGCTTGGGACGCGGNCTTACTTCCACTCTTC
        ||||||||||||||||||||||||||||||||| ||||||||||||||||
 193485 ATGTTTATAAAAATGTACGGGCTTGGGACGCGGCCTTACTTCCACTCTTC

    550     .    :    .    :    .    :    .
    514 CTTCAACTGCTTTGACTGTGGGGTAAGTGCTCTTGTCTC
        |||||||||||||||||||||||||||||||||||| ||
 193535 CTTCAACTGCTTTGACTGTGGGGTAAGTGCTCTTGTTTC

END