Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BQ185075.1
Subject Sequence ID: ENSG00000141837
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BQ185075.1, 761 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000141837 (ENSG00000141837), 298924 bp

>gi|20360626|gb|BQ185075.1|BQ185075 UI-E-EJ1-ajo-b-06-0-UI.s1 UI-E-EJ1 Homo sapiens cDNA clone UI-E-EJ1-ajo-b-06-0-UI 3', mRNA sequence
>ENSG00000141837

346-761  (1-416)   99%

      0     .    :    .    :    .    :    .    :    .    :
    346 CCTCGCCCGGGCTTAGCACCAATCATCGTCACTCTCGCTGTAGGGTTCGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      1 CCTCGCCCGGGCTTAGCACCAATCATCGTCACTCTCGCTGTAGGGTTCGT

     50     .    :    .    :    .    :    .    :    .    :
    396 GCAGGCCCTTCCTGGAGCCCGGCCCGCGGGGCCTGGCCAGTCCGTGCGCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     51 GCAGGCCCTTCCTGGAGCCCGGCCCGCGGGGCCTGGCCAGTCCGTGCGCC

    100     .    :    .    :    .    :    .    :    .    :
    446 GGGTACTAGCCGTTGGGGAGTCGCCGGCCGTGCCGAGAAGGCGAGGCGCA
        ||||| ||||||||||||||||||||||||||||||||||||||||||||
    101 GGGTAGTAGCCGTTGGGGAGTCGCCGGCCGTGCCGAGAAGGCGAGGCGCA

    150     .    :    .    :    .    :    .    :    .    :
    496 GGCCGGGCCCGAGGCCCGGGGAGTCCTGGGCGAGCGCCCGGTGGCGCCCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    151 GGCCGGGCCCGAGGCCCGGGGAGTCCTGGGCGAGCGCCCGGTGGCGCCCG

    200     .    :    .    :    .    :    .    :    .    :
    546 AGGACGCGTGTCGTACGGGGGGTGGCGCGTCGTAGGCCCCGGCCATGGCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    201 AGGACGCGTGTCGTACGGGGGGTGGCGCGTCGTAGGCCCCGGCCATGGCC

    250     .    :    .    :    .    :    .    :    .    :
    596 TCCTCGCCGCCCCCGCTGCCCGGGCCATCGGCCTCGTCGTANTCGGAGCC
        ||||||||||||||||||||||||||||||||||||||||| ||||||||
    251 TCCTCGCCGCCCCCGCTGCCCGGGCCATCGGCCTCGTCGTAGTCGGAGCC

    300     .    :    .    :    .    :    .    :    .    :
    646 CCGGTAGTAGCCATGGTGCCGGGGACCCGGNGGCCCCTCGGACACGTGCG
        |||||||||||||||||||||||||||||| |||||||||||||||||||
    301 CCGGTAGTAGCCATGGTGCCGGGGACCCGGGGGCCCCTCGGACACGTGCG

    350     .    :    .    :    .    :    .    :    .    :
    696 GGCCAAATGCCGGCCACCGGGCCCCGCCGTGTCGACAGGCCCTGGGGGAC
        ||||| ||||||||||||||||||||||||||||||||||||||||||||
    351 GGCCAGATGCCGGCCACCGGGCCCCGCCGTGTCGACAGGCCCTGGGGGAC

    400     .    :    .
    746 TCGCTCCGGGCCGGGC
        ||||||||||||||||
    401 TCGCTCCGGGCCGGGC

END