Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BM713091.1
Subject Sequence ID: ENSG00000141837
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BM713091.1, 374 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000141837 (ENSG00000141837), 298924 bp

>gi|19026342|gb|BM713091.1|BM713091 UI-E-EJ0-ahh-j-16-0-UI.r1 UI-E-EJ0 Homo sapiens cDNA clone UI-E-EJ0-ahh-j-16-0-UI 5', mRNA sequence
>ENSG00000141837

(complement)

1-190  (297280-297469)   99% ->
191-367  (298172-298348)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 GGAGCGGGGCCGGCCCAAGGATCGGAAGCATCGACAGCACCACCACCACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 297280 GGAGCGGGGCCGGCCCAAGGATCGGAAGCATCGACAGCACCACCACCACC

     50     .    :    .    :    .    :    .    :    .    :
     51 ACCACCACCACCACCACCCCCCGCCCCCCGACAAGGACCGCTATGCCCAG
        |||||||||||||||| |||||||||||||||||||||||||||||||||
 297330 ACCACCACCACCACCATCCCCCGCCCCCCGACAAGGACCGCTATGCCCAG

    100     .    :    .    :    .    :    .    :    .    :
    101 GAACGGCCGGACCACGGCCGGGCACGGGCTCGGGACCAGCGCTGGTCCCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 297380 GAACGGCCGGACCACGGCCGGGCACGGGCTCGGGACCAGCGCTGGTCCCG

    150     .    :    .    :    .    :    .    :    .    :
    151 CTCGCCCAGCGAGGGCCGAGAGCACATGGCGCACCGGCAG         G
        ||||||||||||||||||||||||||||||||||||||||>>>...>>>|
 297430 CTCGCCCAGCGAGGGCCGAGAGCACATGGCGCACCGGCAGGTG...TAGG

    200     .    :    .    :    .    :    .    :    .    :
    192 GCAGTAGTTCCGTAAGTGGAAGCCCAGCCCCCTCAACATCTGGTACCAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298173 GCAGTAGTTCCGTAAGTGGAAGCCCAGCCCCCTCAACATCTGGTACCAGC

    250     .    :    .    :    .    :    .    :    .    :
    242 ACTCCGCGGCGGGGCCGCCGCCAGCTCCCCCAGACCCCCTCCACCCCCCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298223 ACTCCGCGGCGGGGCCGCCGCCAGCTCCCCCAGACCCCCTCCACCCCCCG

    300     .    :    .    :    .    :    .    :    .    :
    292 GCCACACGTGTCCTATTCCCCTGTGATCCGTAAGGCCGGCGGCTCGGGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298273 GCCACACGTGTCCTATTCCCCTGTGATCCGTAAGGCCGGCGGCTCGGGGC

    350     .    :    .    :    .
    342 CCCCGCAGCAGCAGCAGCAGCAGCAG
        ||||||||||||||||||||||||||
 298323 CCCCGCAGCAGCAGCAGCAGCAGCAG

END