Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BM313132.1
Subject Sequence ID: ENSG00000141837
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BM313132.1, 501 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000141837 (ENSG00000141837), 298924 bp

>gi|18047477|gb|BM313132.1|BM313132 ig79h05.y1 HR85 islet Homo sapiens cDNA 5' similar to SW:CCAA_HUMAN O00555 VOLTAGE-DEPENDENT P/Q-TYPE CALCIUM CHANNEL ALPHA-1A SUBUNIT ;, mRNA sequence
>ENSG00000141837

(complement)

1-134  (276010-276143)   97% ->
135-240  (281453-281558)   100% ->
241-348  (291617-291724)   100% ->
349-449  (291892-291992)   100% ->
450-501  (293485-293536)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 TTTCTGATGCTGAATCTCTTTGTCGCCGTCATCATGGACAACTTTGAGTA
           | |||||||||||||||||||||||||||||||||||||||||||||
 276010 CCACAGATGCTGAATCTCTTTGTCGCCGTCATCATGGACAACTTTGAGTA

     50     .    :    .    :    .    :    .    :    .    :
     51 CCTCACCCGAGACTCCTCCATCCTGGGCCCCCACCACCTGGATGAGTACG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 276060 CCTCACCCGAGACTCCTCCATCCTGGGCCCCCACCACCTGGATGAGTACG

    100     .    :    .    :    .    :    .    :    .    :
    101 TGCGTGTCTGGGCCGAGTATGACCCCGCAGCTTG         CGGCTTC
        ||||||||||||||||||||||||||||||||||>>>...>>>|||||||
 276110 TGCGTGTCTGGGCCGAGTATGACCCCGCAGCTTGGTA...TAGCGGCTTC

    150     .    :    .    :    .    :    .    :    .    :
    142 TGCGGATGGACCTGCCCGTCGCAGATGACAACACCGTCCACTTCAATTCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 281460 TGCGGATGGACCTGCCCGTCGCAGATGACAACACCGTCCACTTCAATTCC

    200     .    :    .    :    .    :    .    :    .    :
    192 ACCCTCATGGCTCTGATCCGCACAGCCCTGGACATCAAGATTGCCAAGG 
        |||||||||||||||||||||||||||||||||||||||||||||||||>
 281510 ACCCTCATGGCTCTGATCCGCACAGCCCTGGACATCAAGATTGCCAAGGG

    250     .    :    .    :    .    :    .    :    .    :
    241         GAGGAGCCGACAAACAGCAGATGGACGCTGAGCTGCGGAAGG
        >>...>>>||||||||||||||||||||||||||||||||||||||||||
 281560 TA...CAGGAGGAGCCGACAAACAGCAGATGGACGCTGAGCTGCGGAAGG

    300     .    :    .    :    .    :    .    :    .    :
    283 AGATGATGGCGATTTGGCCCAATCTGTCCCAGAAGACGCTAGACCTGCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 291659 AGATGATGGCGATTTGGCCCAATCTGTCCCAGAAGACGCTAGACCTGCTG

    350     .    :    .    :    .    :    .    :    .    :
    333 GTCACACCTCACAAGT         CCACGGACCTCACCGTGGGGAAGAT
        ||||||||||||||||>>>...>>>|||||||||||||||||||||||||
 291709 GTCACACCTCACAAGTGTA...CAGCCACGGACCTCACCGTGGGGAAGAT

    400     .    :    .    :    .    :    .    :    .    :
    374 CTACGCAGCCATGATGATCATGGAGTACTACCGGCAGAGCAAGGCCAAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 291917 CTACGCAGCCATGATGATCATGGAGTACTACCGGCAGAGCAAGGCCAAGA

    450     .    :    .    :    .    :    .    :    .    :
    424 AGCTGCAGGCCATGCGCGAGGAGCAG         GACCGGACACCCCTC
        ||||||||||||||||||||||||||>>>...>>>|||||||||||||||
 291967 AGCTGCAGGCCATGCGCGAGGAGCAGGTG...CAGGACCGGACACCCCTC

    500     .    :    .    :    .    :    .
    465 ATGTTCCAGCGCATGGAGCCCCCGTCCCCAACGCAGG
        |||||||||||||||||||||||||||||||||||||
 293500 ATGTTCCAGCGCATGGAGCCCCCGTCCCCAACGCAGG

END