Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BM312842.1
Subject Sequence ID: ENSG00000141837
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BM312842.1, 589 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000141837 (ENSG00000141837), 298924 bp

>gi|18047187|gb|BM312842.1|BM312842 ig79h05.x1 HR85 islet Homo sapiens cDNA 3' similar to TR:O95387 O95387 VOLTAGE-DEPENDENT P/Q TYPE CALCIUM CHANNEL ALPHA 1A SUBUNIT ;, mRNA sequence
>ENSG00000141837

22-106  (4832-4916)   100% <-
107-245  (5084-5222)   100% <-
246-355  (5331-5440)   98% <-
356-456  (6933-7033)   100% <-
457-573  (7201-7313)   94%

      0     .    :    .    :    .    :    .    :    .    :
     22 AGGCAGCCCGGCCCTGGCCTTCCATGGGGAGGTAGTGCTCGCTGTCGGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4832 AGGCAGCCCGGCCCTGGCCTTCCATGGGGAGGTAGTGCTCGCTGTCGGAG

     50     .    :    .    :    .    :    .    :    .    :
     72 TAGCCATCTCTGCCCATCTCTCGCATCTCCACGGA         CTGAGA
        |||||||||||||||||||||||||||||||||||<<<...<<<||||||
   4882 TAGCCATCTCTGCCCATCTCTCGCATCTCCACGGACTG...CACCTGAGA

    100     .    :    .    :    .    :    .    :    .    :
    113 GTTAGGCTGGCTGTTGGGCATGTCGGTAGGGGGGCCTTGTTCCGGACTCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   5090 GTTAGGCTGGCTGTTGGGCATGTCGGTAGGGGGGCCTTGTTCCGGACTCC

    150     .    :    .    :    .    :    .    :    .    :
    163 ATGTGCCCGTCTTCTGGAACATCTCCTGGGCACGCTGGGTCACCCAGGAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   5140 ATGTGCCCGTCTTCTGGAACATCTCCTGGGCACGCTGGGTCACCCAGGAC

    200     .    :    .    :    .    :    .    :    .    :
    213 GGGCTCTCCTTGAGGCCGCTTTCGTGAGCCATC         TTGGCTCC
        |||||||||||||||||||||||||||||||||<<<...<<<  ||||||
   5190 GGGCTCTCCTTGAGGCCGCTTTCGTGAGCCATCCTG...CACAGGGCTCC

    250     .    :    .    :    .    :    .    :    .    :
    254 TCCTGGGTCCAGCTGGGTGGAGGGGAGGGCGTTCTGGCCAGGTCCCCCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   5339 TCCTGGGTCCAGCTGGGTGGAGGGGAGGGCGTTCTGGCCAGGTCCCCCTT

    300     .    :    .    :    .    :    .    :    .    :
    304 CCTGCGTTGGGGACGGGGGCTCCATGCGCTGGAACATGAGGGGTGTCCGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   5389 CCTGCGTTGGGGACGGGGGCTCCATGCGCTGGAACATGAGGGGTGTCCGG

    350     .    :    .    :    .    :    .    :    .    :
    354 TC         CTGCTCCTCGCGCATGGCCTGCAGCTTCTTGGCCTTGCT
        ||<<<...<<<|||||||||||||||||||||||||||||||||||||||
   5439 TCCTG...CACCTGCTCCTCGCGCATGGCCTGCAGCTTCTTGGCCTTGCT

    400     .    :    .    :    .    :    .    :    .    :
    395 CTGCCGGTAGTACTCCATGATCATCATGGCTGCGTAGATCTTCCCCACGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   6972 CTGCCGGTAGTACTCCATGATCATCATGGCTGCGTAGATCTTCCCCACGG

    450     .    :    .    :    .    :    .    :    .    :
    445 TGAGGTCCGTGG         ACTTGTGAGGTGTGACCAGCAAGTCTAGC
        ||||||||||||<<<...<<<||||||||||||||||||||| |||||||
   7022 TGAGGTCCGTGGCTG...TACACTTGTGAGGTGTGACCAGCAGGTCTAGC

    500     .    :    .    :    .    :    .    :    .    :
    486 GTCTTCTGGGACAGATTGGGCCAAATCGCCATCATCTCCTTTCGCAGCTC
        ||||||||||||||||||||||||||||||||||||||||| ||||||||
   7230 GTCTTCTGGGACAGATTGGGCCAAATCGCCATCATCTCCTTCCGCAGCTC

    550     .    :    .    :    .    :    .
    536 AGCGTCCATCTGCTGTTTGTCGGCTCCCTCCCTTGGCA
        |||||||||||||||||||||||||||-|||--||-||
   7280 AGCGTCCATCTGCTGTTTGTCGGCTCC TCC  TG CA

END