Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BI033107.1
Subject Sequence ID: ENSG00000141837
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BI033107.1, 552 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000141837 (ENSG00000141837), 298924 bp

>gi|14439733|gb|BI033107.1|BI033107 MR4-NN0205-310101-201-f05 NN0205 Homo sapiens cDNA, mRNA sequence
>ENSG00000141837

1-214  (27523-27736)   99% <-
215-280  (27909-27974)   100% <-
281-552  (28314-28585)   97%

      0     .    :    .    :    .    :    .    :    .    :
      1 AGTGGAAGAGGAGGGTACATCCTCTATGGGAACAGAAGGATGAAGGCAGG
        | ||||||||||||||||||||||||||||||||||||||||||||||||
  27523 ATTGGAAGAGGAGGGTACATCCTCTATGGGAACAGAAGGATGAAGGCAGG

     50     .    :    .    :    .    :    .    :    .    :
     51 CACCCCACCCCACGGAAACAGAATTATCAGAGCAGGTCCCCTTCTCACCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  27573 CACCCCACCCCACGGAAACAGAATTATCAGAGCAGGTCCCCTTCTCACCG

    100     .    :    .    :    .    :    .    :    .    :
    101 GAAGAGAAGCATGAGGGCCTGGAAGAAGGTCCGGAAGTTATTGTGCTCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  27623 GAAGAGAAGCATGAGGGCCTGGAAGAAGGTCCGGAAGTTATTGTGCTCAG

    150     .    :    .    :    .    :    .    :    .    :
    151 TGATTTGGAACTCATCTTCATCACTGTCCTCGTCCTCCACGTCGATGCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  27673 TGATTTGGAACTCATCTTCATCACTGTCCTCGTCCTCCACGTCGATGCCA

    200     .    :    .    :    .    :    .    :    .    :
    201 ATGTTACCAAACAC         CTGCATCCCAATGATGGCATAGATGAA
        ||||||||||||||<<<...<<<|||||||||||||||||||||||||||
  27723 ATGTTACCAAACACCTG...CACCTGCATCCCAATGATGGCATAGATGAA

    250     .    :    .    :    .    :    .    :    .    :
    242 GAAGAGCATGGCGATCAGCAGACAGACATAAGGCAGGGC         CT
        |||||||||||||||||||||||||||||||||||||||<<<...<<<||
  27936 GAAGAGCATGGCGATCAGCAGACAGACATAAGGCAGGGCCTG...CACCT

    300     .    :    .    :    .    :    .    :    .    :
    283 TGAAGGACTGCACAAAGGTCCAGAGAAGAATGCGGATGGTGTAACCCTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  28316 TGAAGGACTGCACAAAGGTCCAGAGAAGAATGCGGATGGTGTAACCCTGA

    350     .    :    .    :    .    :    .    :    .    :
    333 CGGAGAAGTTTGATGAGCCGGGCAGCTCGGAAGAGGCGGAGAAAGCTCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  28366 CGGAGAAGTTTGATGAGCCGGGCAGCTCGGAAGAGGCGGAGAAAGCTCAG

    400     .    :    .    :    .    :    .    :    .    :
    383 GTTGATGAAGTTATTCTGGGGAGATGGCGGAAGAGGGGTGACCATCCACC
        ||||||||||||||||||||||||||| ||||||||||||||||||||||
  28416 GTTGATGAAGTTATTCTGGGGAGATGGAGGAAGAGGGGTGACCATCCACC

    450     .    :    .    :    .    :    .    :    .    :
    433 CANCCCAAAAAGCTCAGAGCTGTCACCACTCACAGAGGCCCCTACATGAA
        || ||||||| |||||||||||||||||||||||||||||||||||||||
  28466 CACCCCAAAAGGCTCAGAGCTGTCACCACTCACAGAGGCCCCTACATGAA

    500     .    :    .    :    .    :    .    :    .    :
    483 GCCAAGCAACAGGAAAAAAGCAAGGCAGGACCCAAATAAGGAGGGAGAGA
        ||||| |||||||||||||||||| |||  ||||||||||||||||||||
  28516 GCCAACCAACAGGAAAAAAGCAAGCCAGACCCCAAATAAGGAGGGAGAGA

    550     .    :    .    :
    533 GAAAGCACTATTAATGCAAT
        ||||||||||||||||||||
  28566 GAAAGCACTATTAATGCAAT

END