Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BF732547.1
Subject Sequence ID: ENSG00000141837
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BF732547.1, 193 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000141837 (ENSG00000141837), 298924 bp

>gi|12057622|gb|BF732547.1|BF732547 nae12b08.x1 NCI_CGAP_Ov18 Homo sapiens cDNA clone IMAGE:3434847 3' similar to SW:CCAA_HUMAN O00555 VOLTAGE-DEPENDENT P/Q-TYPE CALCIUM CHANNEL ALPHA-1A SUBUNIT ;contains element MER40 repetitive element ;, mRNA sequence
>ENSG00000141837

1-193  (483-681)   94%

      0     .    :    .    :    .    :    .    :    .    :
      1 CGGCCAGAGGCTCGGCCGTGGGGCCTGGGTACCTACGAGGGCCGCTGGTG
        |||||||||||||||||||||||||||||||||| |||||||||||||||
    483 CGGCCAGAGGCTCGGCCGTGGGGCCTGGGTACCTCCGAGGGCCGCTGGTG

     50     .    :    .    :    .    :    .    :    .    :
     51 GCCGCCCGGCCCGGCCTGGCCACC    GC  CTGCTGCTGCTGCTGCTG
        ||||||||||||||||||||||||----||--||||||||||||||||||
    533 GCCGCCCGGCCCGGCCTGGCCACCGCCTGCTGCTGCTGCTGCTGCTGCTG

    100     .    :    .    :    .    :    .    :    .    :
     95 CTGCTGCTGCTGCTGCGGGGGCCCCGAGCCGCCGGCCTTACGGATCACAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    583 CTGCTGCTGCTGCTGCGGGGGCCCCGAGCCGCCGGCCTTACGGATCACAG

    150     .    :    .    :    .    :    .    :    .
    145 GGGAATAGGACACATGTGGCCGGGGGGTGGAGGGGGTCTGAGGGAAATG
        ||||||||||||| |||||||||||||||||||||||||| ||||  ||
    633 GGGAATAGGACACGTGTGGCCGGGGGGTGGAGGGGGTCTGGGGGAGCTG

END