Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BF726609.1
Subject Sequence ID: ENSG00000141837
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BF726609.1, 326 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000141837 (ENSG00000141837), 298924 bp

>gi|12042520|gb|BF726609.1|BF726609 by09c02.y1 Human Lens cDNA (Un-normalized, unamplified): BY Homo sapiens cDNA clone by09c02 5', mRNA sequence
>ENSG00000141837

(complement)

1-71  (202388-202458)   100% ->
72-139  (202612-202679)   100% ->
140-246  (205569-205675)   100% ->
247-326  (206872-206951)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 GTCTCAGGGGGGCGTGCAGGGCGGCATGGTGTTCTCCATCTATTTCATTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 202388 GTCTCAGGGGGGCGTGCAGGGCGGCATGGTGTTCTCCATCTATTTCATTG

     50     .    :    .    :    .    :    .    :    .    :
     51 TACTGACGCTCTTTGGGAACT         ACACCCTCCTGAATGTGTTC
        |||||||||||||||||||||>>>...>>>||||||||||||||||||||
 202438 TACTGACGCTCTTTGGGAACTGTA...CAGACACCCTCCTGAATGTGTTC

    100     .    :    .    :    .    :    .    :    .    :
     92 TTGGCCATCGCTGTGGACAATCTGGCCAACGCCCAGGAGCTCACCAAG  
        ||||||||||||||||||||||||||||||||||||||||||||||||>>
 202632 TTGGCCATCGCTGTGGACAATCTGGCCAACGCCCAGGAGCTCACCAAGGT

    150     .    :    .    :    .    :    .    :    .    :
    140        GACGAGCAAGAGGAAGAAGAAGCAGCGAACCAGAAACTTGCCC
        >...>>>|||||||||||||||||||||||||||||||||||||||||||
 202682 G...TAGGACGAGCAAGAGGAAGAAGAAGCAGCGAACCAGAAACTTGCCC

    200     .    :    .    :    .    :    .    :    .    :
    183 TACAGAAAGCCAAGGAGGTGGCAGAAGTGAGTCCTCTGTCCGCGGCCAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 205612 TACAGAAAGCCAAGGAGGTGGCAGAAGTGAGTCCTCTGTCCGCGGCCAAC

    250     .    :    .    :    .    :    .    :    .    :
    233 ATGTCTATAGCTGT         GAAAGAGCAACAGAAGAATCAAAAGCC
        ||||||||||||||>>>...>>>|||||||||||||||||||||||||||
 205662 ATGTCTATAGCTGTGTA...CAGGAAAGAGCAACAGAAGAATCAAAAGCC

    300     .    :    .    :    .    :    .    :    .    :
    274 AGCCAAGTCCGTGTGGGAGCAGCGGACCAGTGAGATGCGAAAGCAGAACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 206899 AGCCAAGTCCGTGTGGGAGCAGCGGACCAGTGAGATGCGAAAGCAGAACT

    350 
    324 TGC
        |||
 206949 TGC

END