Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BF529475.1
Subject Sequence ID: ENSG00000141837
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BF529475.1, 885 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000141837 (ENSG00000141837), 298924 bp

>gi|11616838|gb|BF529475.1|BF529475 602043230F1 NCI_CGAP_Brn67 Homo sapiens cDNA clone IMAGE:4181118 5', mRNA sequence
>ENSG00000141837

(complement)

1-113  (253120-253234)   96% ->
114-197  (260960-261043)   97% ->
198-367  (269607-269776)   100% ->
368-483  (270495-270611)   99% ->
484-549  (270951-271016)   100% ->
550-667  (271189-271304)   95% ->
668-795  (274365-274488)   92%

      0     .    :    .    :    .    :    .    :    .    :
      1 GAAGTTCTATGGGGCTTCTGT GCTTATGAAAATGCCCTGCGGGTGTTCA
          |||||||||||||||||||-||||||||||||||||||||||||||||
 253120 CTAGTTCTATGGGGCTTCTGTTGCTTATGAAAATGCCCTGCGGGTGTTCA

     50     .    :    .    :    .    :    .    :    .    :
     50 ACATCGTCTTCACCTCCCTCTTCTCTCTGGAATGTGTGCTGAAAGTCATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 253170 ACATCGTCTTCACCTCCCTCTTCTCTCTGGAATGTGTGCTGAAAGTCATG

    100     .    :    .    :    .    :    .    :    .    :
    100 GCTTT GGGATTCTG         AATTATTTCCGCGATGCCTGGAACAT
        |||||-|||||||||>>>...>>>||||||||||||||||||||||||||
 253220 GCTTTTGGGATTCTGGTA...TAGAATTATTTCCGCGATGCCTGGAACAT

    150     .    :    .    :    .    :    .    :    .    :
    140 CTTCGACTT GTGACTGTTCTGGGCAGCATCACGCGATATCCTCGTGACT
        |||||||||-|||||||||||||||||||||||-||||||||||||||||
 260986 CTTCGACTTTGTGACTGTTCTGGGCAGCATCAC CGATATCCTCGTGACT

    200     .    :    .    :    .    :    .    :    .    :
    189 GAGTTTGGG         GCCTGGTCCCGTGCTACTCCACCCAGCCCCAG
        |||||||||>>>...>>>||||||||||||||||||||||||||||||||
 261035 GAGTTTGGGGTA...CAGGCCTGGTCCCGTGCTACTCCACCCAGCCCCAG

    250     .    :    .    :    .    :    .    :    .    :
    230 AAGCTGAGAAGCCATCCCTGAGAGGGGGGAAAAGGGCCCCAAATGCATCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 269639 AAGCTGAGAAGCCATCCCTGAGAGGGGGGAAAAGGGCCCCAAATGCATCT

    300     .    :    .    :    .    :    .    :    .    :
    280 TCTCCGACTCAGCGGGCAGCGAGGACTCACCCTGCAGCCGAACAGTCCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 269689 TCTCCGACTCAGCGGGCAGCGAGGACTCACCCTGCAGCCGAACAGTCCCA

    350     .    :    .    :    .    :    .    :    .    :
    330 GCTCCCTCCCGTCCTCCCCATTCCCGCTCGCCAAGGGG         AAT
        ||||||||||||||||||||||||||||||||||||||>>>...>>>|||
 269739 GCTCCCTCCCGTCCTCCCCATTCCCGCTCGCCAAGGGGGTA...CAGAAT

    400     .    :    .    :    .    :    .    :    .    :
    371 AACTTCATCAACCTGAGCTTTCTCCGCCTCTTCCGAGCTGCCCGGCTCAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 270498 AACTTCATCAACCTGAGCTTTCTCCGCCTCTTCCGAGCTGCCCGGCTCAT

    450     .    :    .    :    .    :    .    :    .    :
    421 CAAACTTCTCCGTCAGGGTTACACCATCCGCATTCTTCTCTGGACCTT G
        ||||||||||||||||||||||||||||||||||||||||||||||||-|
 270548 CAAACTTCTCCGTCAGGGTTACACCATCCGCATTCTTCTCTGGACCTTTG

    500     .    :    .    :    .    :    .    :    .    :
    470 TGCAGTCCTTCAAG         GCCCTGCCTTATGTCTGTCTGCTGATC
        ||||||||||||||>>>...>>>|||||||||||||||||||||||||||
 270598 TGCAGTCCTTCAAGGTG...CAGGCCCTGCCTTATGTCTGTCTGCTGATC

    550     .    :    .    :    .    :    .    :    .    :
    511 GCCATGCTCTTCTTCATCTATGCCATCATTGGGATGCAG         GT
        |||||||||||||||||||||||||||||||||||||||>>>...>>>||
 270978 GCCATGCTCTTCTTCATCTATGCCATCATTGGGATGCAGGTG...CAGGT

    600     .    :    .    :    .    :    .    :    .    :
    552 GT AGGTAACATTGGCATCGACGTGGAGGACGAGGACAGTGATGAAGATG
        ||- ||||||||||||||||||||||||||||||||||||||||||||||
 271191 GTTTGGTAACATTGGCATCGACGTGGAGGACGAGGACAGTGATGAAGATG

    650     .    :    .    :    .    :    .    :    .    :
    601 AAGTTCCAAATCACTGAGCACAATAAACTTCCGGACCTTCTTCCAGGCCC
        |-||||||||||||||||||||||||-|||||||||||||||||||||||
 271241 A GTTCCAAATCACTGAGCACAATAA CTTCCGGACCTTCTTCCAGGCCC

    700     .    :    .    :    .    :    .    :    .    :
    651 TCATGCTTCTCTTTCCG         GAGTGCCCACCGGGGAAGCTTGGA
        |||||||||||||-|||>>>...>>>|||||||-||||||||||||||| 
 271289 TCATGCTTCTCTT CCGGTG...CAGGAGTGCC ACCGGGGAAGCTTGGC

    750     .    :    .    :    .    :    .    :    .    :
    692 ACAAGCATCATGCTTTCCTGCCTCAAGCGGGAAACCGTGTGATAGGAACT
        ||||-|||||||||||||||||||-||||||||||||||||||| |||||
 274388 ACAA CATCATGCTTTCCTGCCTC AGCGGGAAACCGTGTGATAAGAACT

    800     .    :    .    :    .    :    .    :    .    :
    742 CTGGCATCCTGACTCGAGAGTGTGGCAAGGACATTTGCT ATTTTTAACT
        |||||||||||||||||||||||||||| ||-|||||||-|||||||-||
 274436 CTGGCATCCTGACTCGAGAGTGTGGCAATGA ATTTGCTTATTTTTA CT

    850     .
    791 TGGTT
        | |||
 274484 TTGTT

END