Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BF172043.1
Subject Sequence ID: ENSG00000141837
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BF172043.1, 250 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000141837 (ENSG00000141837), 298924 bp

>gi|13438257|gb|BF172043.1|BF172043 PCL3971 Myeloma (PCL) cDNA library Homo sapiens cDNA, mRNA sequence
>ENSG00000141837

(complement)

1-154  (248722-248875)   98% ->
155-250  (250966-251061)   98%

      0     .    :    .    :    .    :    .    :    .    :
      1 CCCCGGGTACCCCATGGAGATGTCCATTTTCTACGTCGTCTACTTTGTGG
        ||||||||||| ||||||||||||||||||||||||||||||||||||||
 248722 CCCCGGGTACCGCATGGAGATGTCCATTTTCTACGTCGTCTACTTTGTGG

     50     .    :    .    :    .    :    .    :    .    :
     51 GGTTCCCCTTCTTCTTTGTCAATATCTTTGTGGCCTTGATCATCATCACC
         |||||||||||||||||||||||||||||||||||||||||||||||||
 248772 TGTTCCCCTTCTTCTTTGTCAATATCTTTGTGGCCTTGATCATCATCACC

    100     .    :    .    :    .    :    .    :    .    :
    101 TTCCAGGAGCAAGGGGACAAGATGATGGAGGAATACAGCCTGGAGAAAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 248822 TTCCAGGAGCAAGGGGACAAGATGATGGAGGAATACAGCCTGGAGAAAAA

    150     .    :    .    :    .    :    .    :    .    :
    151 TGAG         AGGGCCTGCATTGATTTCGCCATCAGCGCCAAGCCGC
        ||||>>>...>>>|||||||||||||||||||||||||||||||||||||
 248872 TGAGGTG...CAGAGGGCCTGCATTGATTTCGCCATCAGCGCCAAGCCGC

    200     .    :    .    :    .    :    .    :    .    :
    192 TGACCCGACACATGCCGCAGAACAGGCAGAGCTTCCAGTACCGCATGTGG
        |||||||||||||||||||||||| |||||||||||||||||||||||||
 251003 TGACCCGACACATGCCGCAGAACAAGCAGAGCTTCCAGTACCGCATGTGG

    250     .
    242 CAGTTCGTG
        |||||||||
 251053 CAGTTCGTG

END