Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BE888589.1
Subject Sequence ID: ENSG00000141837
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BE888589.1, 744 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000141837 (ENSG00000141837), 298924 bp

>gi|10345045|gb|BE888589.1|BE888589 601512973F1 NIH_MGC_71 Homo sapiens cDNA clone IMAGE:3914034 5', mRNA sequence
>ENSG00000141837

(complement)

1-201  (146420-146619)   98% ->
202-305  (170316-170419)   100% ->
306-744  (171732-172170)   97%

      0     .    :    .    :    .    :    .    :    .    :
      1 GGGACAGATGACATTCAGGGTGAGTCTCCGGCTCCATGTGGGACAGAAGA
          | -|||||||||||||||||||||||||||||||||||||||||||||
 146420 TTGT AGATGACATTCAGGGTGAGTCTCCGGCTCCATGTGGGACAGAAGA

     50     .    :    .    :    .    :    .    :    .    :
     51 GCCCGCCCGCACCTGCCCCAATGGGACCAAATGTCAGCCCTACTGGGAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 146469 GCCCGCCCGCACCTGCCCCAATGGGACCAAATGTCAGCCCTACTGGGAAG

    100     .    :    .    :    .    :    .    :    .    :
    101 GGCCCAACAACGGGATCACTCAGTTCGACAACATCCTGTTTGCAGTGCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 146519 GGCCCAACAACGGGATCACTCAGTTCGACAACATCCTGTTTGCAGTGCTG

    150     .    :    .    :    .    :    .    :    .    :
    151 ACTGTTTTCCAGTGCATAACCATGGAAGGGTGGACTGATCTCCTCTACAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 146569 ACTGTTTTCCAGTGCATAACCATGGAAGGGTGGACTGATCTCCTCTACAA

    200     .    :    .    :    .    :    .    :    .    :
    201 T         AGCAACGATGCCTCAGGGAACACTTGGAACTGGTTGTACT
        |>>>...>>>||||||||||||||||||||||||||||||||||||||||
 146619 TGTA...CAGAGCAACGATGCCTCAGGGAACACTTGGAACTGGTTGTACT

    250     .    :    .    :    .    :    .    :    .    :
    242 TCATCCCCCTCATCATCATCGGCTCCTTTTTTATGCTGAACCTTGTGCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 170356 TCATCCCCCTCATCATCATCGGCTCCTTTTTTATGCTGAACCTTGTGCTG

    300     .    :    .    :    .    :    .    :    .    :
    292 GGTGTGCTGTCAGG         GGAGTTTGCCAAAGAAAGGGAACGGGT
        ||||||||||||||>>>...>>>|||||||||||||||||||||||||||
 170406 GGTGTGCTGTCAGGGTA...CAGGGAGTTTGCCAAAGAAAGGGAACGGGT

    350     .    :    .    :    .    :    .    :    .    :
    333 GGAGAACCGGCGGGCTTTTCTGAAGCTGAGGCGGCAACAACAGATTGAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 171759 GGAGAACCGGCGGGCTTTTCTGAAGCTGAGGCGGCAACAACAGATTGAAC

    400     .    :    .    :    .    :    .    :    .    :
    383 GTGAGCTCAATGGGTACATGGAATGGATCTCAAAAGCAGGTGAGGCCCTT
        |||||||||||||||||||||| |||||||||||||||||||||||||||
 171809 GTGAGCTCAATGGGTACATGGAGTGGATCTCAAAAGCAGGTGAGGCCCTT

    450     .    :    .    :    .    :    .    :    .    :
    433 TCATCCTGGGGCCCAGG ATGGAGATCCCAGGCCACAGAGTACAAAGAGA
        |||||||||||||||||-|||||||||||||||||| |||||||||||||
 171859 TCATCCTGGGGCCCAGGGATGGAGATCCCAGGCCACGGAGTACAAAGAGA

    500     .    :    .    :    .    :    .    :    .    :
    482 GTCATGCAGTTTGGAGAAGGCTAAGCTGGGAGGGTTATGATGGGAGGAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 171909 GTCATGCAGTTTGGAGAAGGCTAAGCTGGGAGGGTTATGATGGGAGGAGA

    550     .    :    .    :    .    :    .    :    .    :
    532 AAGAGAACCTTGAATTGGTAGTCCCAAATTTTATCAACAAGAATCCAGAG
        ||||||||||-|||||||||||||||||||||||||||||||||||||||
 171959 AAGAGAACCT GAATTGGTAGTCCCAAATTTTATCAACAAGAATCCAGAG

    600     .    :    .    :    .    :    .    :    .    :
    582 TCTGATATGAAGAAGTCTAAGATGAAGCCAGGATCTGACATCACGTAACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 172008 TCTGATATGAAGAAGTCTAAGATGAAGCCAGGATCTGACATCACGTAACT

    650     .    :    .    :    .    :    .    :    .    :
    632 TGAATTCTGAAATCAGACGCTGGTTTACATCCCGGGCCTGCCACTTTTTA
        ||||||||||||||||||||||||||||||||||| ||||||||||||||
 172058 TGAATTCTGAAATCAGACGCTGGTTTACATCCCGGCCCTGCCACTTTTTA

    700     .    :    .    :    .    :    .    :    .    :
    682 CCCATGGCACCACACATTCCTGTACCTCCGTTTCCTCAG TCTTACATGG
        ||||||-|||||||||| |||||||||||||||||||||-| ||||||||
 172108 CCCATG CACCACACATCCCTGTACCTCCGTTTCCTCAGCTGTTACATGG

    750     .    :    .
    731 AGGCGATG AATGTG
        ||||||||- |-|||
 172157 AGGCGATGGTA GTG

END