Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BE672345.1
Subject Sequence ID: ENSG00000141837
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BE672345.1, 214 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000141837 (ENSG00000141837), 298924 bp

>gi|10032886|gb|BE672345.1|BE672345 7a59g05.x1 NCI_CGAP_GC6 Homo sapiens cDNA clone IMAGE:3223064 3' similar to SW:CCAA_HUMAN O00555 VOLTAGE-DEPENDENT P/Q-TYPE CALCIUM CHANNEL ALPHA-1A SUBUNIT ;contains element MER40 repetitive element ;, mRNA sequence
>ENSG00000141837

1-214  (447-668)   95%

      0     .    :    .    :    .    :    .    :    .    :
      1 GGCCGCTGCTGTGGCCCCCCGTGGGCGGCCGATCTCCTTCCAGAGGCTCG
        |||||||||||||||||||||||||||||||||||||  |||||||||||
    447 GGCCGCTGCTGTGGCCCCCCGTGGGCGGCCGATCTCCGGCCAGAGGCTCG

     50     .    :    .    :    .    :    .    :    .    :
     51 GCCGAGGGGCCTGGGTACCTCCGAGGGCCGCTGGTGGCCGCCCGGCCCGG
        |||| |||||||||||||||||||||||||||||||||||||||||||||
    497 GCCGTGGGGCCTGGGTACCTCCGAGGGCCGCTGGTGGCCGCCCGGCCCGG

    100     .    :    .    :    .    :    .    :    .    :
    101 CCTGGCCACCGCCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC G  
        ||||||||||||||||||||||||||||||||||||||||||||||-|--
    547 CCTGGCCACCGCCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT

    150     .    :    .    :    .    :    .    :    .    :
    148    GGGGCCCCGAGCCGCCGGCCTTACGGATCACAGGGGAATAGGACACG
        ---|||||||||||||||||||||||||||||||||||||||||||||||
    597 GCGGGGGCCCCGAGCCGCCGGCCTTACGGATCACAGGGGAATAGGACACG

    200     .    :    .    :
    195 TG G CCGGGGGGTGGAGGGGG
        ||-|-|||||||||||||||||
    647 TGTGGCCGGGGGGTGGAGGGGG

END