Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BE464861.1
Subject Sequence ID: ENSG00000141837
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BE464861.1, 326 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000141837 (ENSG00000141837), 298924 bp

>gi|9510555|gb|BE464861.1|BE464861 hv73b05.x1 NCI_CGAP_Lu24 Homo sapiens cDNA clone IMAGE:3179025 3', mRNA sequence
>ENSG00000141837

10-51  (61586-61625)   85%

      0     .    :    .    :    .    :    .    :
     10 GATTCAACTTTTTTTTATTTTTTTTTTCTTTTTGAATGTCAT
        ||||| |||||||||| |||||||||| |||||||-|| -||
  61586 GATTCTACTTTTTTTTTTTTTTTTTTTTTTTTTGA TGG AT

END