Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW594118.1
Subject Sequence ID: ENSG00000141837
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW594118.1, 184 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000141837 (ENSG00000141837), 298924 bp

>gi|7281479|gb|AW594118.1|AW594118 hg55h02.x1 NCI_CGAP_GC6 Homo sapiens cDNA clone IMAGE:2949555 3' similar to SW:CCAA_HUMAN O00555 VOLTAGE-DEPENDENT P/Q-TYPE CALCIUM CHANNEL ALPHA-1A SUBUNIT ;contains element PTR5 repetitive element ;, mRNA sequence
>ENSG00000141837

1-184  (477-668)   95%

      0     .    :    .    :    .    :    .    :    .    :
      1 TATCTCCGGCCAGAGGCTCGGCCGTGGGGCCTGGGTACCTCCGAGGGCCG
         |||||||||||||||||||||||||||||||||||||||||||||||||
    477 GATCTCCGGCCAGAGGCTCGGCCGTGGGGCCTGGGTACCTCCGAGGGCCG

     50     .    :    .    :    .    :    .    :    .    :
     51 CTGGTGGCCGCCCGGCCCGGCCTGGCCACCGCCTGCTGCTGCTGCTGCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    527 CTGGTGGCCGCCCGGCCCGGCCTGGCCACCGCCTGCTGCTGCTGCTGCTG

    100     .    :    .    :    .    :    .    :    .    :
    101 CTGCTGCTGCTGCTGC G  G   GGGCCCCGAGCCGCCGGCCTTACGGA
        ||||||||||||||||-|--|---||||||||||||||||||||||||||
    577 CTGCTGCTGCTGCTGCTGCTGCGGGGGCCCCGAGCCGCCGGCCTTACGGA

    150     .    :    .    :    .    :    .    :
    145 TCACAGGGGAATAGGACACGTG G CCGGGGGGTGGAGGGGG
        ||||||||||||||||||||||-|-|||||||||||||||||
    627 TCACAGGGGAATAGGACACGTGTGGCCGGGGGGTGGAGGGGG

END