Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW593481.1
Subject Sequence ID: ENSG00000141837
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW593481.1, 251 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000141837 (ENSG00000141837), 298924 bp

>gi|7280739|gb|AW593481.1|AW593481 hg16h01.x1 NCI_CGAP_GC6 Homo sapiens cDNA clone IMAGE:2945809 3', mRNA sequence
>ENSG00000141837

1-35  (61586-61620)   91% ==
216-251  (226844-226876)   77%

      0     .    :    .    :    .    :    .
      1 GATTCAACTTTTTTTTATTTTTTTTTTCTTTTTGA
        ||||| |||||||||| |||||||||| |||||||
  61586 GATTCTACTTTTTTTTTTTTTTTTTTTTTTTTTGA

      0     .    :    .    :    .    :    .
    216 TTTAAAATTGTTTATTGTTATTATTATTTTTTTAAA
        || |  |||||| -|||||||||||||||||--| |
 226844 TTCACTATTGTTG TTGTTATTATTATTTTT  AGA

END