Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW235775.1
Subject Sequence ID: ENSG00000141837
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW235775.1, 295 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000141837 (ENSG00000141837), 298924 bp

>gi|6568164|gb|AW235775.1|AW235775 xm45f06.x1 NCI_CGAP_GC6 Homo sapiens cDNA clone IMAGE:2687171 3', mRNA sequence
>ENSG00000141837

1-35  (61586-61620)   91% ==
218-254  (226844-226879)   78%

      0     .    :    .    :    .    :    .
      1 GATTCAACTTTTTTTTATTTTTTTTTTCTTTTTGA
        ||||| |||||||||| |||||||||| |||||||
  61586 GATTCTACTTTTTTTTTTTTTTTTTTTTTTTTTGA

      0     .    :    .    :    .    :    .
    218 TTTAAAATTGTTTATTGTTATTATTATTTTTTTAAAT
        || |  |||||| -|||||||||||||||||  | ||
 226844 TTCACTATTGTTG TTGTTATTATTATTTTTAGAGAT

END