Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AU148997.1
Subject Sequence ID: ENSG00000012048
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AU148997.1, 545 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000012048 (ENSG00000012048), 81091 bp

>gi|11010518|gb|AU148997.1|AU148997 AU148997 NT2RM4 Homo sapiens cDNA clone NT2RM4001388 3', mRNA sequence
>ENSG00000012048

1-517  (524-1041)   98%

      0     .    :    .    :    .    :    .    :    .    :
      1 GAGCCACAGTCTCACTGTCACCCAGGCTGGAGTGCCGTGGTATGATCTTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    524 GAGCCACAGTCTCACTGTCACCCAGGCTGGAGTGCCGTGGTATGATCTTG

     50     .    :    .    :    .    :    .    :    .    :
     51 GCTCACTGCAACCTCCACCTCCCGGGCTGAAGTGATTCTCCTGCCTTAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    574 GCTCACTGCAACCTCCACCTCCCGGGCTGAAGTGATTCTCCTGCCTTAGC

    100     .    :    .    :    .    :    .    :    .    :
    101 CACCTGAGTAGCTGGGATTACAGGTGTCCACCACCATGACCGGCTAATTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    624 CACCTGAGTAGCTGGGATTACAGGTGTCCACCACCATGACCGGCTAATTT

    150     .    :    .    :    .    :    .    :    .    :
    151 CTGTATTTTTAGTAGAGATGGGGTTTCACCATGTTGGCCAGGCTGGTTTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    674 CTGTATTTTTAGTAGAGATGGGGTTTCACCATGTTGGCCAGGCTGGTTTC

    200     .    :    .    :    .    :    .    :    .    :
    201 GAACTCCTGACCTCCAGTGATCTGCCCACCTTGGCCTCCCAAAGTGCTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    724 GAACTCCTGACCTCCAGTGATCTGCCCACCTTGGCCTCCCAAAGTGCTGG

    250     .    :    .    :    .    :    .    :    .    :
    251 GATTACAGGCGTGAGCCACCATGCCCAGGTTTCAAGTTTCCTTTTCATTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    774 GATTACAGGCGTGAGCCACCATGCCCAGGTTTCAAGTTTCCTTTTCATTT

    300     .    :    .    :    .    :    .    :    .    :
    301 CTAATACCTGCCTCAGAATTTCCTCCCCAATGTTCCACTCCAACATTTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    824 CTAATACCTGCCTCAGAATTTCCTCCCCAATGTTCCACTCCAACATTTGA

    350     .    :    .    :    .    :    .    :    .    :
    351 GAACTGCCCAAGGACTATTCTGACTTTAAGTCACATAATCGATCCCAAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    874 GAACTGCCCAAGGACTATTCTGACTTTAAGTCACATAATCGATCCCAAGC

    400     .    :    .    :    .    :    .    :    .    :
    401 ACTCTCCTTCCATTGAAGGGTCTGACTCTCTGCCTTTGTGAACACAGGGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    924 ACTCTCCTTCCATTGAAGGGTCTGACTCTCTGCCTTTGTGAACACAGGGT

    450     .    :    .    :    .    :    .    :    .    :
    451 TTTAGAGAAGTAAACTTANGGAAACCAGCTATTCTCTTGAGGGCCAA CC
        |||||||||||||||||| |||||||||||||||||||||||-||||-||
    974 TTTAGAGAAGTAAACTTAGGGAAACCAGCTATTCTCTTGAGG CCAAGCC

    500     .    :    .
    500 ACTNTGTGCTTC AGGCCT
        ||| ||||||||-|| |||
   1023 ACTCTGTGCTTCCAGCCCT

END