Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AL601892.1
Subject Sequence ID: ENSG00000139618
Subject Sequence type: 2


seq1 = /RAID/mart2/Splice/web_temp/fasta/AL601892.1, 718 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000139618 (ENSG00000139618), 84189 bp

>gi|15165398|gb|AL601892.1|AL601892 DKFZp313O137_r1 313 (synonym: hlcc2) Homo sapiens cDNA clone DKFZp313O137 5', mRNA sequence
>ENSG00000139618

11-198  (1-188)   99% ->
199-304  (943-1048)   100% ->
305-553  (3598-3846)   100% ->
554-662  (9597-9705)   100% ->
663-718  (10622-10676)   96%

      0     .    :    .    :    .    :    .    :    .    :
     11 GTGGCGCGAGCTTCTGAAACTAGGCGGCAGAGGCGGAGCCGCTGTGGCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      1 GTGGCGCGAGCTTCTGAAACTAGGCGGCAGAGGCGGAGCCGCTGTGGCAC

     50     .    :    .    :    .    :    .    :    .    :
     61 TGCTGCGCCTCTGCTGCGCCTCGGGTGTCTTTTGCGGCGGTGGGTCGCCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     51 TGCTGCGCCTCTGCTGCGCCTCGGGTGTCTTTTGCGGCGGTGGGTCGCCG

    100     .    :    .    :    .    :    .    :    .    :
    111 CCGGGAGAAGCGTGAGGGGACAGATTTGTGACCGGCGCGGTTTTTGTCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    101 CCGGGAGAAGCGTGAGGGGACAGATTTGTGACCGGCGCGGTTTTTGTCAG

    150     .    :    .    :    .    :    .    :    .    :
    161 CTTACTCCGGCCAAAAAAGAACTGCGCCTCTGGAGCGG         ACT
        ||||||||||||||||||||||||| ||||||||||||>>>...>>>|||
    151 CTTACTCCGGCCAAAAAAGAACTGCACCTCTGGAGCGGGTT...CAGACT

    200     .    :    .    :    .    :    .    :    .    :
    202 TATTTACCAAGCATTGGAGGAATATCGTAGGTAAAAATGCCTATTGGATC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    946 TATTTACCAAGCATTGGAGGAATATCGTAGGTAAAAATGCCTATTGGATC

    250     .    :    .    :    .    :    .    :    .    :
    252 CAAAGAGAGGCCAACATTTTTTGAAATTTTTAAGACACGCTGCAACAAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    996 CAAAGAGAGGCCAACATTTTTTGAAATTTTTAAGACACGCTGCAACAAAG

    300     .    :    .    :    .    :    .    :    .    :
    302 CAG         ATTTAGGACCAATAAGTCTTAATTGGTTTGAAGAACTT
        |||>>>...>>>||||||||||||||||||||||||||||||||||||||
   1046 CAGGTA...TAGATTTAGGACCAATAAGTCTTAATTGGTTTGAAGAACTT

    350     .    :    .    :    .    :    .    :    .    :
    343 TCTTCAGAAGCTCCACCCTATAATTCTGAACCTGCAGAAGAATCTGAACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   3636 TCTTCAGAAGCTCCACCCTATAATTCTGAACCTGCAGAAGAATCTGAACA

    400     .    :    .    :    .    :    .    :    .    :
    393 TAAAAACAACAATTACGAACCAAACCTATTTAAAACTCCACAAAGGAAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   3686 TAAAAACAACAATTACGAACCAAACCTATTTAAAACTCCACAAAGGAAAC

    450     .    :    .    :    .    :    .    :    .    :
    443 CATCTTATAATCAGCTGGCTTCAACTCCAATAATATTCAAAGAGCAAGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   3736 CATCTTATAATCAGCTGGCTTCAACTCCAATAATATTCAAAGAGCAAGGG

    500     .    :    .    :    .    :    .    :    .    :
    493 CTGACTCTGCCGCTGTACCAATCTCCTGTAAAAGAATTAGATAAATTCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   3786 CTGACTCTGCCGCTGTACCAATCTCCTGTAAAAGAATTAGATAAATTCAA

    550     .    :    .    :    .    :    .    :    .    :
    543 ATTAGACTTAG         GAAGGAATGTTCCCAATAGTAGACATAAAA
        |||||||||||>>>...>>>||||||||||||||||||||||||||||||
   3836 ATTAGACTTAGGTA...CAGGAAGGAATGTTCCCAATAGTAGACATAAAA

    600     .    :    .    :    .    :    .    :    .    :
    584 GTCTTCGCACAGTGAAAACTAAAATGGATCAAGCAGATGATGTTTCCTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   9627 GTCTTCGCACAGTGAAAACTAAAATGGATCAAGCAGATGATGTTTCCTGT

    650     .    :    .    :    .    :    .    :    .    :
    634 CCACTTCTAAATTCTTGTCTTAGTGAAAG         TCCTGTTGTTCT
        |||||||||||||||||||||||||||||>>>...>>>||||||||||||
   9677 CCACTTCTAAATTCTTGTCTTAGTGAAAGGTA...TAGTCCTGTTGTTCT

    700     .    :    .    :    .    :    .    :
    675 ACAATGTACACATGTAACACCACAAAGAGATAAGTCAGTGGATG
        ||||||||||||||||||||||||||||||||||||||-| |||
  10634 ACAATGTACACATGTAACACCACAAAGAGATAAGTCAG GTATG

END