Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AI932384.1
Subject Sequence ID: ENSG00000141837
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AI932384.1, 401 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000141837 (ENSG00000141837), 298924 bp

>gi|5671121|gb|AI932384.1|AI932384 wd27g05.x1 Soares_NFL_T_GBC_S1 Homo sapiens cDNA clone IMAGE:2329400 3' similar to TR:Q99791 Q99791 ALPHA1A-VOLTAGE-DEPENDENT CALCIUM CHANNEL. ;contains element MSR1 repetitive element ;, mRNA sequence
>ENSG00000141837

1-401  (445-842)   99%

      0     .    :    .    :    .    :    .    :    .    :
      1 GCGGCCGCTGCTGTGGCCCCCCGTGGGCGGCCGATCTCCGGTCAGAGGCT
        ||||||||||||||||||||||||||||||||||||||||| ||||||||
    445 GCGGCCGCTGCTGTGGCCCCCCGTGGGCGGCCGATCTCCGGCCAGAGGCT

     50     .    :    .    :    .    :    .    :    .    :
     51 CGGCCGTGGGGCCTGGGTACCTCCGAGGGCCGCTGGTGGCCGCCCGGCCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    495 CGGCCGTGGGGCCTGGGTACCTCCGAGGGCCGCTGGTGGCCGCCCGGCCC

    100     .    :    .    :    .    :    .    :    .    :
    101 GGCCTGGCCACCGCCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG
        |||||||||||||-|--|||||||||||||||||||||||||||||||||
    545 GGCCTGGCCACCG C  CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG

    150     .    :    .    :    .    :    .    :    .    :
    151 CTGCTGCGGGGGCCCCGAGCCGCCGGCCTTACGGATCACAGGGGAATAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    592 CTGCTGCGGGGGCCCCGAGCCGCCGGCCTTACGGATCACAGGGGAATAGG

    200     .    :    .    :    .    :    .    :    .    :
    201 ACACGTGTGGCCGGGGGGTGGAGGGGGTCTGGGGGAGCTGGCGGCGGCCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    642 ACACGTGTGGCCGGGGGGTGGAGGGGGTCTGGGGGAGCTGGCGGCGGCCC

    250     .    :    .    :    .    :    .    :    .    :
    251 CGCCGCGGAGTGCTGGTACCAGATGTTGAGGGGGCTGGGCTTCCACTTAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    692 CGCCGCGGAGTGCTGGTACCAGATGTTGAGGGGGCTGGGCTTCCACTTAC

    300     .    :    .    :    .    :    .    :    .    :
    301 GGAACTACTGCCCTACACGAAAATTGAAACAAAGGAAATCAAAAAAAAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    742 GGAACTACTGCCCTACACGAAAATTGAAACAAAGGAAATCAAAAAAAAAG

    350     .    :    .    :    .    :    .    :    .    :
    351 ATACAACAAAATCAAAGGAGACACGGGATTGGGAGGAAGAGAGGGGAGCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    792 ATACAACAAAATCAAAGGAGACACGGGATTGGGAGGAAGAGAGGGGAGCG

    400 
    401 A
        |
    842 A

END