Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AI680547.1
Subject Sequence ID: ENSG00000012048
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AI680547.1, 409 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000012048 (ENSG00000012048), 81091 bp

>gi|4890729|gb|AI680547.1|AI680547 tw82d05.x1 NCI_CGAP_Ut3 Homo sapiens cDNA clone IMAGE:2266185 3' similar to contains Alu repetitive element;, mRNA sequence
>ENSG00000012048

1-409  (522-930)   99%

      0     .    :    .    :    .    :    .    :    .    :
      1 TTGAGCCACAGTCTCACTGTCACCCAGGCTGGAGTGCCGTGGTATGATCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    522 TTGAGCCACAGTCTCACTGTCACCCAGGCTGGAGTGCCGTGGTATGATCT

     50     .    :    .    :    .    :    .    :    .    :
     51 TGGCTCACTGCAACCTCCACCTCCCGGGCTGAAGTGATTCTCCTGCCTTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    572 TGGCTCACTGCAACCTCCACCTCCCGGGCTGAAGTGATTCTCCTGCCTTA

    100     .    :    .    :    .    :    .    :    .    :
    101 GCCACCTGAGTAGCTGGGATTACAGGTGTCCACCACCATGACCGGCTAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    622 GCCACCTGAGTAGCTGGGATTACAGGTGTCCACCACCATGACCGGCTAAT

    150     .    :    .    :    .    :    .    :    .    :
    151 TTCTGTATTTTTAGTAGAGATGGGGTTTCACCATGTTGGCCAGGCTGGTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    672 TTCTGTATTTTTAGTAGAGATGGGGTTTCACCATGTTGGCCAGGCTGGTT

    200     .    :    .    :    .    :    .    :    .    :
    201 TCGAACTCCTGACCTCCAGTGATCTGCCCACCTTGGCCTCCCAAAGTGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    722 TCGAACTCCTGACCTCCAGTGATCTGCCCACCTTGGCCTCCCAAAGTGCT

    250     .    :    .    :    .    :    .    :    .    :
    251 GGGATTACAGGCGTGAGCCACCATGCCCAGGTTTCAAGTTTCCTTTTCAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    772 GGGATTACAGGCGTGAGCCACCATGCCCAGGTTTCAAGTTTCCTTTTCAT

    300     .    :    .    :    .    :    .    :    .    :
    301 TTCTAATACCTGCCTCAGAATTTCCTCCCCAATGTTCCACTCCAACATTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    822 TTCTAATACCTGCCTCAGAATTTCCTCCCCAATGTTCCACTCCAACATTT

    350     .    :    .    :    .    :    .    :    .    :
    351 GAGAACTGCCCAAGGACTATTCTGANCTTAAGTCACATAATCGATCCCAA
        |||||||||||||||||||||||||  |||||||||||||||||||||||
    872 GAGAACTGCCCAAGGACTATTCTGACTTTAAGTCACATAATCGATCCCAA

    400     .
    401 GCACTCTCC
        |||||||||
    922 GCACTCTCC

END