Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AI652330.1
Subject Sequence ID: ENSG00000141837
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AI652330.1, 300 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000141837 (ENSG00000141837), 298924 bp

>gi|4736309|gb|AI652330.1|AI652330 wb60c03.x1 NCI_CGAP_GC6 Homo sapiens cDNA clone IMAGE:2310052 3', mRNA sequence
>ENSG00000141837

77-106  (9034-9063)   80%

      0     .    :    .    :    .    :
     77 TTGT TTATTGTTATTATTTTTTTAAATTGA
        || |-||||||||||||||||| -| || ||
   9034 TTTTATTATTGTTATTATTTTTG AGATGGA

END