Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AI590622.1
Subject Sequence ID: ENSG00000141837
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AI590622.1, 514 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000141837 (ENSG00000141837), 298924 bp

>gi|4599670|gb|AI590622.1|AI590622 tw24c08.x1 NCI_CGAP_Ov35 Homo sapiens cDNA clone IMAGE:2260622 3' similar to TR:Q99791 Q99791 ALPHA1A-VOLTAGE-DEPENDENT CALCIUM CHANNEL. ;contains MER22.b1 MER22 repetitive element ;, mRNA sequence
>ENSG00000141837

(complement)

1-453  (298472-298924)   99%

      0     .    :    .    :    .    :    .    :    .    :
      1 AGCGGCCGCTCGCCCAGGATGGAGAGGCGGGTCCCAGGCCCGGCCCGGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298472 AGCGGCCGCTCGCCCAGGATGGAGAGGCGGGTCCCAGGCCCGGCCCGGAG

     50     .    :    .    :    .    :    .    :    .    :
     51 CGAGTCCCCCAGGGCCTGTCGACACGGCGGGGCCCGGTGGCCGGCATCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298522 CGAGTCCCCCAGGGCCTGTCGACACGGCGGGGCCCGGTGGCCGGCATCTG

    100     .    :    .    :    .    :    .    :    .    :
    101 GCCCGCACGTGTCCGAGGGGCCCCCGGGTCCCCGGCACCATGGCTACTAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298572 GCCCGCACGTGTCCGAGGGGCCCCCGGGTCCCCGGCACCATGGCTACTAC

    150     .    :    .    :    .    :    .    :    .    :
    151 CGGGGCTCCGACTACGACGAGGCCGATGGCCCGGGCAGCGGGGGCGGCGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298622 CGGGGCTCCGACTACGACGAGGCCGATGGCCCGGGCAGCGGGGGCGGCGA

    200     .    :    .    :    .    :    .    :    .    :
    201 GGAGGCCATGGCCGGGGCCTACGACGCGCCACCCCCCGTACGACACGCGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298672 GGAGGCCATGGCCGGGGCCTACGACGCGCCACCCCCCGTACGACACGCGT

    250     .    :    .    :    .    :    .    :    .    :
    251 NCTCGGGCGCCACCGGGCGCTCGCCCAGGACTCCCCGGGCCTCGGGCCCG
         |||||||||||||||||||||||||||||||||||||||||||||||||
 298722 CCTCGGGCGCCACCGGGCGCTCGCCCAGGACTCCCCGGGCCTCGGGCCCG

    300     .    :    .    :    .    :    .    :    .    :
    301 GCCTGCGCCTCGCCTTCTCGGCACGGCCGGCGACTCCCCAACGGCTACTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298772 GCCTGCGCCTCGCCTTCTCGGCACGGCCGGCGACTCCCCAACGGCTACTA

    350     .    :    .    :    .    :    .    :    .    :
    351 CCCGGCGCACGGACTGGCCAGGCCCCGCGGGCCGGGCTCCAGGAAGGGCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298822 CCCGGCGCACGGACTGGCCAGGCCCCGCGGGCCGGGCTCCAGGAAGGGCC

    400     .    :    .    :    .    :    .    :    .    :
    401 TGCACGAACCCTACAGCGAGAGTGACGATGATTGGTGCTAAGCCCGGGCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298872 TGCACGAACCCTACAGCGAGAGTGACGATGATTGGTGCTAAGCCCGGGCG

    450 
    451 AGG
        |||
 298922 AGG

END