Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AI217721.1
Subject Sequence ID: ENSG00000012048
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AI217721.1, 311 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000012048 (ENSG00000012048), 81091 bp

>gi|3797536|gb|AI217721.1|AI217721 qh15g08.x1 Soares_NFL_T_GBC_S1 Homo sapiens cDNA clone IMAGE:1844798 3', mRNA sequence
>ENSG00000012048

7-311  (1-305)   99%

      0     .    :    .    :    .    :    .    :    .    :
      7 TGTTTGCTACCAAGTTTATTTGCAGTGTTAACAGCACAACATTTACAAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      1 TGTTTGCTACCAAGTTTATTTGCAGTGTTAACAGCACAACATTTACAAAA

     50     .    :    .    :    .    :    .    :    .    :
     57 CGTATTTTGTACAATCAAGTCTTCACTGCCCTTGCACACTAGGGGGGCTA
        |||||||||||||||||||||||||||||||||||||||| |||||||||
     51 CGTATTTTGTACAATCAAGTCTTCACTGCCCTTGCACACTGGGGGGGCTA

    100     .    :    .    :    .    :    .    :    .    :
    107 GGGAAGACCTAGTCCTTCCAACAGCTATAAACAGTCCTGGATAATGGGTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    101 GGGAAGACCTAGTCCTTCCAACAGCTATAAACAGTCCTGGATAATGGGTT

    150     .    :    .    :    .    :    .    :    .    :
    157 TATGAAAAACACTTTTTCTTCCTTCAGCAAGCAAAATTATTTATGAAGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    151 TATGAAAAACACTTTTTCTTCCTTCAGCAAGCAAAATTATTTATGAAGCT

    200     .    :    .    :    .    :    .    :    .    :
    207 GTATGGTTTCAGCAACAGGGAGCAAAGGAAAAAAATCACCTCAAAGAAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    201 GTATGGTTTCAGCAACAGGGAGCAAAGGAAAAAAATCACCTCAAAGAAAG

    250     .    :    .    :    .    :    .    :    .    :
    257 CAACAGCTTCCTTCCTGGTGGGATCTGTCATTTTATAGATATGAAATATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    251 CAACAGCTTCCTTCCTGGTGGGATCTGTCATTTTATAGATATGAAATATT

    300     .
    307 CATGC
        |||||
    301 CATGC

END