Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AI086488.1
Subject Sequence ID: ENSG00000141837
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AI086488.1, 441 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000141837 (ENSG00000141837), 298924 bp

>gi|3424911|gb|AI086488.1|AI086488 oz60a05.x1 Soares_senescent_fibroblasts_NbHSF Homo sapiens cDNA clone IMAGE:1679696 3' similar to TR:Q99791 Q99791 ALPHA1A-VOLTAGE-DEPENDENT CALCIUM CHANNEL. ;contains element PTR5 repetitive element ;, mRNA sequence
>ENSG00000141837

1-306  (445-753)   99% <-
307-441  (1456-1590)   98%

      0     .    :    .    :    .    :    .    :    .    :
      1 GCGGCCGCTGCTGTGGCCCCCCGTGGGCGGCCGATCTCCGGCCAGAGGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    445 GCGGCCGCTGCTGTGGCCCCCCGTGGGCGGCCGATCTCCGGCCAGAGGCT

     50     .    :    .    :    .    :    .    :    .    :
     51 CGGCCGTGGGGCCTGGGTACCTCCGAGGGCCGCTGGTGGCCGCCCGGCCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    495 CGGCCGTGGGGCCTGGGTACCTCCGAGGGCCGCTGGTGGCCGCCCGGCCC

    100     .    :    .    :    .    :    .    :    .    :
    101 GGCCTGGCCACCG C  CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG
        |||||||||||||-|--|||||||||||||||||||||||||||||||||
    545 GGCCTGGCCACCGCCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG

    150     .    :    .    :    .    :    .    :    .    :
    148 CTGCGGGGGCCCCGAGCCGCCGGCCTTACGGATCACAGGGGAATAGGACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    595 CTGCGGGGGCCCCGAGCCGCCGGCCTTACGGATCACAGGGGAATAGGACA

    200     .    :    .    :    .    :    .    :    .    :
    198 CGTGTGGCCGGGGGGTGGAGGGGGTCTGGGGGAGCTGGCGGCGGCCCCGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    645 CGTGTGGCCGGGGGGTGGAGGGGGTCTGGGGGAGCTGGCGGCGGCCCCGC

    250     .    :    .    :    .    :    .    :    .    :
    248 CGCGGAGTGCTGGTACCAGATGTTGAGGGGGCTGGGCTTCCACTTACGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    695 CGCGGAGTGCTGGTACCAGATGTTGAGGGGGCTGGGCTTCCACTTACGGA

    300     .    :    .    :    .    :    .    :    .    :
    298 ACTACTGCC         CTGCCGGTGCGCCATGTGCTCTCGGCCCTCGC
        |||||||||<<<...<<<||||||||||||||||||||||||||||||||
    745 ACTACTGCCCTA...CACCTGCCGGTGCGCCATGTGCTCTCGGCCCTCGC

    350     .    :    .    :    .    :    .    :    .    :
    339 TGGGCGAGCGGGACCAGCGCTGGTCCCGAGCCCGTGCCCGGCCGTGGTCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   1488 TGGGCGAGCGGGACCAGCGCTGGTCCCGAGCCCGTGCCCGGCCGTGGTCC

    400     .    :    .    :    .    :    .    :    .    :
    389 GGCCGTTCCTGGGCATAGCGGTCCTTGTCGGGGGGCGGNGGGTGGTGGTG
        |||||||||||||||||||||||||||||||||||||| || ||||||||
   1538 GGCCGTTCCTGGGCATAGCGGTCCTTGTCGGGGGGCGGGGGATGGTGGTG

    450 
    439 GTG
        |||
   1588 GTG

END