Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AF100774.1
Subject Sequence ID: ENSG00000141837
Subject Sequence type: 2


seq1 = /RAID/mart2/Splice/web_temp/fasta/AF100774.1, 3758 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000141837 (ENSG00000141837), 298924 bp

>gi|3873284|gb|AF100774.1|AF100774 Homo sapiens voltage-dependent P/Q type calcium channel alpha 1A subunit (CACNA1A) mRNA, partial cds
>ENSG00000141837

(complement)

1-51  (248825-248875)   100% ->
52-216  (250966-251130)   100% ->
217-327  (253124-253234)   100% ->
328-411  (260960-261043)   100% ->
412-528  (270495-270611)   100% ->
529-594  (270951-271016)   100% ->
595-710  (271189-271304)   100% ->
711-861  (274365-274515)   100% ->
862-989  (276016-276143)   100% ->
990-1086  (277430-277526)   100% ->
1087-1192  (281453-281558)   100% ->
1193-1300  (291617-291724)   100% ->
1301-1401  (291892-291992)   100% ->
1402-1511  (293485-293594)   100% ->
1512-1650  (293703-293841)   100% ->
1651-1764  (294009-294122)   100% ->
1765-1951  (296727-296913)   100% ->
1952-2205  (297216-297469)   99% ->
2206-2955  (298172-298924)   99%

      0     .    :    .    :    .    :    .    :    .    :
      1 CAGGAGCAAGGGGACAAGATGATGGAGGAATACAGCCTGGAGAAAAATGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 248825 CAGGAGCAAGGGGACAAGATGATGGAGGAATACAGCCTGGAGAAAAATGA

     50     .    :    .    :    .    :    .    :    .    :
     51 G         AGGGCCTGCATTGATTTCGCCATCAGCGCCAAGCCGCTGA
        |>>>...>>>||||||||||||||||||||||||||||||||||||||||
 248875 GGTG...CAGAGGGCCTGCATTGATTTCGCCATCAGCGCCAAGCCGCTGA

    100     .    :    .    :    .    :    .    :    .    :
     92 CCCGACACATGCCGCAGAACAAGCAGAGCTTCCAGTACCGCATGTGGCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 251006 CCCGACACATGCCGCAGAACAAGCAGAGCTTCCAGTACCGCATGTGGCAG

    150     .    :    .    :    .    :    .    :    .    :
    142 TTCGTGGTGTCTCCGCCTTTCGAGTACACGATCATGGCCATGATCGCCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 251056 TTCGTGGTGTCTCCGCCTTTCGAGTACACGATCATGGCCATGATCGCCCT

    200     .    :    .    :    .    :    .    :    .    :
    192 CAACACCATCGTGCTTATGATGAAG         TTCTATGGGGCTTCTG
        |||||||||||||||||||||||||>>>...>>>||||||||||||||||
 251106 CAACACCATCGTGCTTATGATGAAGGTA...TAGTTCTATGGGGCTTCTG

    250     .    :    .    :    .    :    .    :    .    :
    233 TTGCTTATGAAAATGCCCTGCGGGTGTTCAACATCGTCTTCACCTCCCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 253140 TTGCTTATGAAAATGCCCTGCGGGTGTTCAACATCGTCTTCACCTCCCTC

    300     .    :    .    :    .    :    .    :    .    :
    283 TTCTCTCTGGAATGTGTGCTGAAAGTCATGGCTTTTGGGATTCTG     
        |||||||||||||||||||||||||||||||||||||||||||||>>>..
 253190 TTCTCTCTGGAATGTGTGCTGAAAGTCATGGCTTTTGGGATTCTGGTA..

    350     .    :    .    :    .    :    .    :    .    :
    328     AATTATTTCCGCGATGCCTGGAACATCTTCGACTTTGTGACTGTTC
        .>>>||||||||||||||||||||||||||||||||||||||||||||||
 253240 .TAGAATTATTTCCGCGATGCCTGGAACATCTTCGACTTTGTGACTGTTC

    400     .    :    .    :    .    :    .    :    .    :
    374 TGGGCAGCATCACCGATATCCTCGTGACTGAGTTTGGG         AAT
        ||||||||||||||||||||||||||||||||||||||>>>...>>>|||
 261006 TGGGCAGCATCACCGATATCCTCGTGACTGAGTTTGGGGTA...CAGAAT

    450     .    :    .    :    .    :    .    :    .    :
    415 AACTTCATCAACCTGAGCTTTCTCCGCCTCTTCCGAGCTGCCCGGCTCAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 270498 AACTTCATCAACCTGAGCTTTCTCCGCCTCTTCCGAGCTGCCCGGCTCAT

    500     .    :    .    :    .    :    .    :    .    :
    465 CAAACTTCTCCGTCAGGGTTACACCATCCGCATTCTTCTCTGGACCTTTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 270548 CAAACTTCTCCGTCAGGGTTACACCATCCGCATTCTTCTCTGGACCTTTG

    550     .    :    .    :    .    :    .    :    .    :
    515 TGCAGTCCTTCAAG         GCCCTGCCTTATGTCTGTCTGCTGATC
        ||||||||||||||>>>...>>>|||||||||||||||||||||||||||
 270598 TGCAGTCCTTCAAGGTG...CAGGCCCTGCCTTATGTCTGTCTGCTGATC

    600     .    :    .    :    .    :    .    :    .    :
    556 GCCATGCTCTTCTTCATCTATGCCATCATTGGGATGCAG         GT
        |||||||||||||||||||||||||||||||||||||||>>>...>>>||
 270978 GCCATGCTCTTCTTCATCTATGCCATCATTGGGATGCAGGTG...CAGGT

    650     .    :    .    :    .    :    .    :    .    :
    597 GTTTGGTAACATTGGCATCGACGTGGAGGACGAGGACAGTGATGAAGATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 271191 GTTTGGTAACATTGGCATCGACGTGGAGGACGAGGACAGTGATGAAGATG

    700     .    :    .    :    .    :    .    :    .    :
    647 AGTTCCAAATCACTGAGCACAATAACTTCCGGACCTTCTTCCAGGCCCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 271241 AGTTCCAAATCACTGAGCACAATAACTTCCGGACCTTCTTCCAGGCCCTC

    750     .    :    .    :    .    :    .    :    .    :
    697 ATGCTTCTCTTCCG         GAGTGCCACCGGGGAAGCTTGGCACAA
        ||||||||||||||>>>...>>>|||||||||||||||||||||||||||
 271291 ATGCTTCTCTTCCGGTG...CAGGAGTGCCACCGGGGAAGCTTGGCACAA

    800     .    :    .    :    .    :    .    :    .    :
    738 CATCATGCTTTCCTGCCTCAGCGGGAAACCGTGTGATAAGAACTCTGGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 274392 CATCATGCTTTCCTGCCTCAGCGGGAAACCGTGTGATAAGAACTCTGGCA

    850     .    :    .    :    .    :    .    :    .    :
    788 TCCTGACTCGAGAGTGTGGCAATGAATTTGCTTATTTTTACTTTGTTTCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 274442 TCCTGACTCGAGAGTGTGGCAATGAATTTGCTTATTTTTACTTTGTTTCC

    900     .    :    .    :    .    :    .    :    .    :
    838 TTCATCTTCCTCTGCTCGTTTCTG         ATGCTGAATCTCTTTGT
        ||||||||||||||||||||||||>>>...>>>|||||||||||||||||
 274492 TTCATCTTCCTCTGCTCGTTTCTGGTG...CAGATGCTGAATCTCTTTGT

    950     .    :    .    :    .    :    .    :    .    :
    879 CGCCGTCATCATGGACAACTTTGAGTACCTCACCCGAGACTCCTCCATCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 276033 CGCCGTCATCATGGACAACTTTGAGTACCTCACCCGAGACTCCTCCATCC

   1000     .    :    .    :    .    :    .    :    .    :
    929 TGGGCCCCCACCACCTGGATGAGTACGTGCGTGTCTGGGCCGAGTATGAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 276083 TGGGCCCCCACCACCTGGATGAGTACGTGCGTGTCTGGGCCGAGTATGAC

   1050     .    :    .    :    .    :    .    :    .    :
    979 CCCGCAGCTTG         CGGTCGGATTCATTATAAGGATATGTACAG
        |||||||||||>>>...>>>||||||||||||||||||||||||||||||
 276133 CCCGCAGCTTGGTA...CAGCGGTCGGATTCATTATAAGGATATGTACAG

   1100     .    :    .    :    .    :    .    :    .    :
   1020 TTTATTACGAGTAATATCTCCCCCTCTCGGCTTAGGCAAGAAATGTCCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 277460 TTTATTACGAGTAATATCTCCCCCTCTCGGCTTAGGCAAGAAATGTCCTC

   1150     .    :    .    :    .    :    .    :    .    :
   1070 ATAGGGTTGCTTGCAAG         CGGCTTCTGCGGATGGACCTGCCC
        |||||||||||||||||>>>...>>>||||||||||||||||||||||||
 277510 ATAGGGTTGCTTGCAAGGTT...TAGCGGCTTCTGCGGATGGACCTGCCC

   1200     .    :    .    :    .    :    .    :    .    :
   1111 GTCGCAGATGACAACACCGTCCACTTCAATTCCACCCTCATGGCTCTGAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 281477 GTCGCAGATGACAACACCGTCCACTTCAATTCCACCCTCATGGCTCTGAT

   1250     .    :    .    :    .    :    .    :    .    :
   1161 CCGCACAGCCCTGGACATCAAGATTGCCAAGG         GAGGAGCCG
        ||||||||||||||||||||||||||||||||>>>...>>>|||||||||
 281527 CCGCACAGCCCTGGACATCAAGATTGCCAAGGGTA...CAGGAGGAGCCG

   1300     .    :    .    :    .    :    .    :    .    :
   1202 ACAAACAGCAGATGGACGCTGAGCTGCGGAAGGAGATGATGGCGATTTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 291626 ACAAACAGCAGATGGACGCTGAGCTGCGGAAGGAGATGATGGCGATTTGG

   1350     .    :    .    :    .    :    .    :    .    :
   1252 CCCAATCTGTCCCAGAAGACGCTAGACCTGCTGGTCACACCTCACAAGT 
        |||||||||||||||||||||||||||||||||||||||||||||||||>
 291676 CCCAATCTGTCCCAGAAGACGCTAGACCTGCTGGTCACACCTCACAAGTG

   1400     .    :    .    :    .    :    .    :    .    :
   1301         CCACGGACCTCACCGTGGGGAAGATCTACGCAGCCATGATGA
        >>...>>>||||||||||||||||||||||||||||||||||||||||||
 291726 TA...CAGCCACGGACCTCACCGTGGGGAAGATCTACGCAGCCATGATGA

   1450     .    :    .    :    .    :    .    :    .    :
   1343 TCATGGAGTACTACCGGCAGAGCAAGGCCAAGAAGCTGCAGGCCATGCGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 291934 TCATGGAGTACTACCGGCAGAGCAAGGCCAAGAAGCTGCAGGCCATGCGC

   1500     .    :    .    :    .    :    .    :    .    :
   1393 GAGGAGCAG         GACCGGACACCCCTCATGTTCCAGCGCATGGA
        |||||||||>>>...>>>||||||||||||||||||||||||||||||||
 291984 GAGGAGCAGGTG...CAGGACCGGACACCCCTCATGTTCCAGCGCATGGA

   1550     .    :    .    :    .    :    .    :    .    :
   1434 GCCCCCGTCCCCAACGCAGGAAGGGGGACCTGGCCAGAACGCCCTCCCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 293517 GCCCCCGTCCCCAACGCAGGAAGGGGGACCTGGCCAGAACGCCCTCCCCT

   1600     .    :    .    :    .    :    .    :    .    :
   1484 CCACCCAGCTGGACCCAGGAGGAGCCCT         GATGGCTCACGAA
        ||||||||||||||||||||||||||||>>>...>>>|||||||||||||
 293567 CCACCCAGCTGGACCCAGGAGGAGCCCTGTG...CAGGATGGCTCACGAA

   1650     .    :    .    :    .    :    .    :    .    :
   1525 AGCGGCCTCAAGGAGAGCCCGTCCTGGGTGACCCAGCGTGCCCAGGAGAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 293716 AGCGGCCTCAAGGAGAGCCCGTCCTGGGTGACCCAGCGTGCCCAGGAGAT

   1700     .    :    .    :    .    :    .    :    .    :
   1575 GTTCCAGAAGACGGGCACATGGAGTCCGGAACAAGGCCCCCCTACCGACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 293766 GTTCCAGAAGACGGGCACATGGAGTCCGGAACAAGGCCCCCCTACCGACA

   1750     .    :    .    :    .    :    .    :    .    :
   1625 TGCCCAACAGCCAGCCTAACTCTCAG         TCCGTGGAGATGCGA
        ||||||||||||||||||||||||||>>>...>>>|||||||||||||||
 293816 TGCCCAACAGCCAGCCTAACTCTCAGGTG...CAGTCCGTGGAGATGCGA

   1800     .    :    .    :    .    :    .    :    .    :
   1666 GAGATGGGCAGAGATGGCTACTCCGACAGCGAGCACTACCTCCCCATGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 294024 GAGATGGGCAGAGATGGCTACTCCGACAGCGAGCACTACCTCCCCATGGA

   1850     .    :    .    :    .    :    .    :    .    :
   1716 AGGCCAGGGCCGGGCTGCCTCCATGCCCCGCCTCCCTGCAGAGAACCAG 
        |||||||||||||||||||||||||||||||||||||||||||||||||>
 294074 AGGCCAGGGCCGGGCTGCCTCCATGCCCCGCCTCCCTGCAGAGAACCAGG

   1900     .    :    .    :    .    :    .    :    .    :
   1765         ACCATCTCAGACACCAGCCCCATGAAGCGTTCAGCCTCCGTG
        >>...>>>||||||||||||||||||||||||||||||||||||||||||
 294124 TG...CAGACCATCTCAGACACCAGCCCCATGAAGCGTTCAGCCTCCGTG

   1950     .    :    .    :    .    :    .    :    .    :
   1807 CTGGGCCCCAAGGCCCGACGCCTGGACGATTACTCGCTGGAGCGGGTCCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 296769 CTGGGCCCCAAGGCCCGACGCCTGGACGATTACTCGCTGGAGCGGGTCCC

   2000     .    :    .    :    .    :    .    :    .    :
   1857 GCCCGAGGAGAACCAGCGGCACCACCAGCGGCGCCGCGACCGCAGCCACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 296819 GCCCGAGGAGAACCAGCGGCACCACCAGCGGCGCCGCGACCGCAGCCACC

   2050     .    :    .    :    .    :    .    :    .    :
   1907 GCGCCTCTGAGCGCTCCCTGGGCCGCTACACCGATGTGGACACAG     
        |||||||||||||||||||||||||||||||||||||||||||||>>>..
 296869 GCGCCTCTGAGCGCTCCCTGGGCCGCTACACCGATGTGGACACAGGTG..

   2100     .    :    .    :    .    :    .    :    .    :
   1952     GCTTGGGGACAGACCTGAGCATGACCACCCAATCCGGGGACCTGCC
        .>>>||||||||||||||||||||||||||||||||||||||||||||||
 296919 .CAGGCTTGGGGACAGACCTGAGCATGACCACCCAATCCGGGGACCTGCC

   2150     .    :    .    :    .    :    .    :    .    :
   1998 GTCGAAGGAGCGGGACCAGGAGCGGGGCCGGCCCAAGGATCGGAAGCATC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 297262 GTCGAAGGAGCGGGACCAGGAGCGGGGCCGGCCCAAGGATCGGAAGCATC

   2200     .    :    .    :    .    :    .    :    .    :
   2048 GACAGCACCACCACCACCACCACCACCACCACCACCCCCCGCCCCCCGAC
        |||||||||||||||||||||||||||||||||| |||||||||||||||
 297312 GACAGCACCACCACCACCACCACCACCACCACCATCCCCCGCCCCCCGAC

   2250     .    :    .    :    .    :    .    :    .    :
   2098 AAGGACCGCTATGCCCAGGAACGGCCGGACCACGGCCGGGCACGGGCTCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 297362 AAGGACCGCTATGCCCAGGAACGGCCGGACCACGGCCGGGCACGGGCTCG

   2300     .    :    .    :    .    :    .    :    .    :
   2148 GGACCAGCGCTGGTCCCGCTCGCCCAGCGAGGGCCGAGAGCACATGGCGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 297412 GGACCAGCGCTGGTCCCGCTCGCCCAGCGAGGGCCGAGAGCACATGGCGC

   2350     .    :    .    :    .    :    .    :    .    :
   2198 ACCGGCAG         GGCAGTAGTTCCGTAAGTGGAAGCCCAGCCCCC
        ||||||||>>>...>>>|||||||||||||||||||||||||||||||||
 297462 ACCGGCAGGTG...TAGGGCAGTAGTTCCGTAAGTGGAAGCCCAGCCCCC

   2400     .    :    .    :    .    :    .    :    .    :
   2239 TCAACATCTGGTACCAGCACTCCGCGGCGGGGCCGCCGCCAGCTCCCCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298205 TCAACATCTGGTACCAGCACTCCGCGGCGGGGCCGCCGCCAGCTCCCCCA

   2450     .    :    .    :    .    :    .    :    .    :
   2289 GACCCCCTCCACCCCCCGGCCACACGTGTCCTATTCCCCTGTGATCCGTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298255 GACCCCCTCCACCCCCCGGCCACACGTGTCCTATTCCCCTGTGATCCGTA

   2500     .    :    .    :    .    :    .    :    .    :
   2339 AGGCCGGCGGCTCGGGG CCCC C GCAGCAGCAGCAGCAGCAGCAGCAG
        |||||||||||||||||-||||-|-|||||||||||||||||||||||||
 298305 AGGCCGGCGGCTCGGGGCCCCCGCAGCAGCAGCAGCAGCAGCAGCAGCAG

   2550     .    :    .    :    .    :    .    :    .    :
   2386 CAGCAGCAGCAGGCGGTGGCCAGGCCGGGCCGGGCGGCCACCAGCGGCCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298355 CAGCAGCAGCAGGCGGTGGCCAGGCCGGGCCGGGCGGCCACCAGCGGCCC

   2600     .    :    .    :    .    :    .    :    .    :
   2436 TCGGAGGTACCCAGGCCCCACGGCCGAGCCTCTGGCCGGAGATCGGCCGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298405 TCGGAGGTACCCAGGCCCCACGGCCGAGCCTCTGGCCGGAGATCGGCCGC

   2650     .    :    .    :    .    :    .    :    .    :
   2486 CCACGGGGGGCCACAGCAGCGGCCGCTCGCCCAGGATGGAGAGGCGGGTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298455 CCACGGGGGGCCACAGCAGCGGCCGCTCGCCCAGGATGGAGAGGCGGGTC

   2700     .    :    .    :    .    :    .    :    .    :
   2536 CCAGGCCCGGCCCGGAGCGAGTCCCCCAGGGCCTGTCGACACGGCGGGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298505 CCAGGCCCGGCCCGGAGCGAGTCCCCCAGGGCCTGTCGACACGGCGGGGC

   2750     .    :    .    :    .    :    .    :    .    :
   2586 CCGGTGGCCGGCATCTGGCCCGCACGTGTCCGAGGGGCCCCCGGGTCCCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298555 CCGGTGGCCGGCATCTGGCCCGCACGTGTCCGAGGGGCCCCCGGGTCCCC

   2800     .    :    .    :    .    :    .    :    .    :
   2636 GGCACCATGGCTACTACCGGGGCTCCGACTACGACGAGGCCGATGGCCCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298605 GGCACCATGGCTACTACCGGGGCTCCGACTACGACGAGGCCGATGGCCCG

   2850     .    :    .    :    .    :    .    :    .    :
   2686 GGCAGCGGGGGCGGCGAGGAGGCCATGGCCGGGGCCTACGACGCGCCACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298655 GGCAGCGGGGGCGGCGAGGAGGCCATGGCCGGGGCCTACGACGCGCCACC

   2900     .    :    .    :    .    :    .    :    .    :
   2736 CCCCGTACGACACGCGTCCTCGGGCGCCACCGGGCGCTCGCCCAGGACTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298705 CCCCGTACGACACGCGTCCTCGGGCGCCACCGGGCGCTCGCCCAGGACTC

   2950     .    :    .    :    .    :    .    :    .    :
   2786 CCCGGGCCTCGGGCCCGGCCTGCGCCTCGCCTTCTCGGCACGGCCGGCGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298755 CCCGGGCCTCGGGCCCGGCCTGCGCCTCGCCTTCTCGGCACGGCCGGCGA

   3000     .    :    .    :    .    :    .    :    .    :
   2836 CTCCCCAACGGCTACTACCCGGCGCACGGACTGGCCAGGCCCCGCGGGCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298805 CTCCCCAACGGCTACTACCCGGCGCACGGACTGGCCAGGCCCCGCGGGCC

   3050     .    :    .    :    .    :    .    :    .    :
   2886 GGGCTCCAGGAAGGGCCTGCACGAACCCTACAGCGAGAGTGACGATGATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298855 GGGCTCCAGGAAGGGCCTGCACGAACCCTACAGCGAGAGTGACGATGATT

   3100     .    :    .    :
   2936 GGTGCTAAGCCCGGGCGAGG
        ||||||||||||||||||||
 298905 GGTGCTAAGCCCGGGCGAGG

END