Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AF004883.1
Subject Sequence ID: ENSG00000141837
Subject Sequence type: 2


seq1 = /RAID/mart2/Splice/web_temp/fasta/AF004883.1, 7791 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000141837 (ENSG00000141837), 298924 bp

>gi|2213910|gb|AF004883.1|AF004883 Homo sapiens neuronal calcium channel alpha 1A subunit isoform 1A-2 mRNA, complete cds
>ENSG00000141837

(complement)

237-529  (1-293)   100% ->
530-635  (51013-51118)   100% ->
636-775  (53210-53349)   100% ->
776-867  (134446-134537)   100% ->
868-1020  (140756-140908)   100% ->
1021-1214  (146426-146619)   100% ->
1215-1318  (170316-170419)   100% ->
1319-1434  (171732-171847)   99% ->
1435-1491  (173300-173356)   100% ->
1492-1584  (175889-175981)   100% ->
1585-1794  (188904-189113)   100% ->
1795-1907  (193444-193556)   100% ->
1908-2020  (197697-197809)   100% ->
2021-2152  (197974-198105)   100% ->
2153-2225  (198371-198443)   100% ->
2226-2343  (202341-202458)   100% ->
2344-2420  (202612-202688)   100% ->
2421-2527  (205569-205675)   100% ->
2528-3337  (206872-207681)   100% ->
3338-3801  (219259-219722)   100% ->
3802-3940  (221019-221157)   100% ->
3941-4070  (222829-222958)   100% ->
4071-4130  (229097-229156)   98% ->
4131-4237  (230269-230375)   100% ->
4238-4337  (243392-243491)   100% ->
4338-4498  (244615-244775)   100% ->
4499-4636  (246524-246661)   100% ->
4637-4838  (248674-248875)   100% ->
4839-5003  (250966-251130)   100% ->
5004-5114  (253124-253234)   100% ->
5115-5204  (260960-261047)   94% ->
5205-5321  (270495-270611)   100% ->
5322-5387  (270951-271016)   100% ->
5388-5503  (271189-271304)   100% ->
5504-5654  (274365-274515)   100% ->
5655-5782  (276016-276143)   100% ->
5783-5879  (278698-278794)   100% ->
5880-5985  (281453-281558)   100% ->
5986-6093  (291617-291724)   100% ->
6094-6194  (291892-291992)   100% ->
6195-6304  (293485-293594)   100% ->
6305-6443  (293703-293841)   100% ->
6444-6557  (294009-294122)   100% ->
6558-6593  (295573-295608)   100% ->
6594-6780  (296727-296913)   100% ->
6781-7034  (297216-297469)   100% ->
7035-7764  (298177-298924)   97%

      0     .    :    .    :    .    :    .    :    .    :
    237 ATGGCCCGCTTCGGAGACGAGATGCCGGCCCGCTACGGGGGAGGAGGCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      1 ATGGCCCGCTTCGGAGACGAGATGCCGGCCCGCTACGGGGGAGGAGGCTC

     50     .    :    .    :    .    :    .    :    .    :
    287 CGGGGCAGCCGCCGGGGTGGTCGTGGGCAGCGGAGGCGGGCGAGGAGCCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     51 CGGGGCAGCCGCCGGGGTGGTCGTGGGCAGCGGAGGCGGGCGAGGAGCCG

    100     .    :    .    :    .    :    .    :    .    :
    337 GGGGCAGCCGGCAGGGCGGGCAGCCCGGGGCGCAAAGGATGTACAAGCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    101 GGGGCAGCCGGCAGGGCGGGCAGCCCGGGGCGCAAAGGATGTACAAGCAG

    150     .    :    .    :    .    :    .    :    .    :
    387 TCAATGGCGCAGAGAGCGCGGACCATGGCACTCTACAACCCCATCCCCGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    151 TCAATGGCGCAGAGAGCGCGGACCATGGCACTCTACAACCCCATCCCCGT

    200     .    :    .    :    .    :    .    :    .    :
    437 CCGACAGAACTGCCTCACGGTTAACCGGTCTCTCTTCCTCTTCAGCGAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    201 CCGACAGAACTGCCTCACGGTTAACCGGTCTCTCTTCCTCTTCAGCGAAG

    250     .    :    .    :    .    :    .    :    .    :
    487 ACAACGTGGTGAGAAAATACGCCAAAAAGATCACCGAATGGCC       
        |||||||||||||||||||||||||||||||||||||||||||>>>...>
    251 ACAACGTGGTGAGAAAATACGCCAAAAAGATCACCGAATGGCCATA...T

    300     .    :    .    :    .    :    .    :    .    :
    530   TCCCTTTGAATATATGATTTTAGCCACCATCATAGCGAATTGCATCGT
        >>||||||||||||||||||||||||||||||||||||||||||||||||
  51011 ACTCCCTTTGAATATATGATTTTAGCCACCATCATAGCGAATTGCATCGT

    350     .    :    .    :    .    :    .    :    .    :
    578 CCTCGCACTGGAGCAGCATCTGCCTGATGATGACAAGACCCCGATGTCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  51061 CCTCGCACTGGAGCAGCATCTGCCTGATGATGACAAGACCCCGATGTCTG

    400     .    :    .    :    .    :    .    :    .    :
    628 AACGGCTG         GATGACACAGAACCATACTTCATTGGAATTTTT
        ||||||||>>>...>>>|||||||||||||||||||||||||||||||||
  51111 AACGGCTGGTG...CAGGATGACACAGAACCATACTTCATTGGAATTTTT

    450     .    :    .    :    .    :    .    :    .    :
    669 TGTTTCGAGGCTGGAATTAAAATCATTGCCCTTGGGTTTGCCTTCCACAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  53243 TGTTTCGAGGCTGGAATTAAAATCATTGCCCTTGGGTTTGCCTTCCACAA

    500     .    :    .    :    .    :    .    :    .    :
    719 AGGCTCCTACTTGAGGAATGGCTGGAATGTCATGGACTTTGTGGTGGTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  53293 AGGCTCCTACTTGAGGAATGGCTGGAATGTCATGGACTTTGTGGTGGTGC

    550     .    :    .    :    .    :    .    :    .    :
    769 TAACGGG         CATCTTGGCGACAGTTGGGACGGAGTTTGACCTA
        |||||||>>>...>>>||||||||||||||||||||||||||||||||||
  53343 TAACGGGGTA...CAGCATCTTGGCGACAGTTGGGACGGAGTTTGACCTA

    600     .    :    .    :    .    :    .    :    .    :
    810 CGGACGCTGAGGGCAGTTCGAGTGCTGCGGCCGCTCAAGCTGGTGTCTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 134480 CGGACGCTGAGGGCAGTTCGAGTGCTGCGGCCGCTCAAGCTGGTGTCTGG

    650     .    :    .    :    .    :    .    :    .    :
    860 AATCCCAA         GTTTACAAGTCGTCCTGAAGTCGATCATGAAGG
        ||||||||>>>...>>>|||||||||||||||||||||||||||||||||
 134530 AATCCCAAGTG...CAGGTTTACAAGTCGTCCTGAAGTCGATCATGAAGG

    700     .    :    .    :    .    :    .    :    .    :
    901 CGATGATCCCTTTGCTGCAGATCGGCCTCCTCCTATTTTTTGCAATCCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 140789 CGATGATCCCTTTGCTGCAGATCGGCCTCCTCCTATTTTTTGCAATCCTT

    750     .    :    .    :    .    :    .    :    .    :
    951 ATTTTTGCAATCATAGGGTTAGAATTTTATATGGGAAAATTTCATACCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 140839 ATTTTTGCAATCATAGGGTTAGAATTTTATATGGGAAAATTTCATACCAC

    800     .    :    .    :    .    :    .    :    .    :
   1001 CTGCTTTGAAGAGGGGACAG         ATGACATTCAGGGTGAGTCTC
        ||||||||||||||||||||>>>...>>>|||||||||||||||||||||
 140889 CTGCTTTGAAGAGGGGACAGGTA...TAGATGACATTCAGGGTGAGTCTC

    850     .    :    .    :    .    :    .    :    .    :
   1042 CGGCTCCATGTGGGACAGAAGAGCCCGCCCGCACCTGCCCCAATGGGACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 146447 CGGCTCCATGTGGGACAGAAGAGCCCGCCCGCACCTGCCCCAATGGGACC

    900     .    :    .    :    .    :    .    :    .    :
   1092 AAATGTCAGCCCTACTGGGAAGGGCCCAACAACGGGATCACTCAGTTCGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 146497 AAATGTCAGCCCTACTGGGAAGGGCCCAACAACGGGATCACTCAGTTCGA

    950     .    :    .    :    .    :    .    :    .    :
   1142 CAACATCCTGTTTGCAGTGCTGACTGTTTTCCAGTGCATAACCATGGAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 146547 CAACATCCTGTTTGCAGTGCTGACTGTTTTCCAGTGCATAACCATGGAAG

   1000     .    :    .    :    .    :    .    :    .    :
   1192 GGTGGACTGATCTCCTCTACAAT         AGCAACGATGCCTCAGGG
        |||||||||||||||||||||||>>>...>>>||||||||||||||||||
 146597 GGTGGACTGATCTCCTCTACAATGTA...CAGAGCAACGATGCCTCAGGG

   1050     .    :    .    :    .    :    .    :    .    :
   1233 AACACTTGGAACTGGTTGTACTTCATCCCCCTCATCATCATCGGCTCCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 170334 AACACTTGGAACTGGTTGTACTTCATCCCCCTCATCATCATCGGCTCCTT

   1100     .    :    .    :    .    :    .    :    .    :
   1283 TTTTATGCTGAACCTTGTGCTGGGTGTGCTGTCAGG         GGAGT
        ||||||||||||||||||||||||||||||||||||>>>...>>>|||||
 170384 TTTTATGCTGAACCTTGTGCTGGGTGTGCTGTCAGGGTA...CAGGGAGT

   1150     .    :    .    :    .    :    .    :    .    :
   1324 TTGCCAAAGAAAGGGAACGGGTGGAGAACCGGCGGGCTTTTCTGAAGCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 171737 TTGCCAAAGAAAGGGAACGGGTGGAGAACCGGCGGGCTTTTCTGAAGCTG

   1200     .    :    .    :    .    :    .    :    .    :
   1374 AGGCGGCAACAACAGATTGAACGTGAGCTCAATGGGTACATGGAATGGAT
        |||||||||||||||||||||||||||||||||||||||||||| |||||
 171787 AGGCGGCAACAACAGATTGAACGTGAGCTCAATGGGTACATGGAGTGGAT

   1250     .    :    .    :    .    :    .    :    .    :
   1424 CTCAAAAGCAG         AAGAGGTGATCCTCGCCGAGGATGAAACTG
        |||||||||||>>>...>>>||||||||||||||||||||||||||||||
 171837 CTCAAAAGCAGGTG...CAGAAGAGGTGATCCTCGCCGAGGATGAAACTG

   1300     .    :    .    :    .    :    .    :    .    :
   1465 ACGGGGAGCAGAGGCATCCCTTTGATG         GAGCTCTGCGGAGA
        |||||||||||||||||||||||||||>>>...>>>||||||||||||||
 173330 ACGGGGAGCAGAGGCATCCCTTTGATGGTA...TTGGAGCTCTGCGGAGA

   1350     .    :    .    :    .    :    .    :    .    :
   1506 ACCACCATAAAGAAAAGCAAGACAGATTTGCTCAACCCCGAAGAGGCTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 175903 ACCACCATAAAGAAAAGCAAGACAGATTTGCTCAACCCCGAAGAGGCTGA

   1400     .    :    .    :    .    :    .    :    .    :
   1556 GGATCAGCTGGCTGATATAGCCTCTGTGG         GTTCTCCCTTCG
        |||||||||||||||||||||||||||||>>>...>>>||||||||||||
 175953 GGATCAGCTGGCTGATATAGCCTCTGTGGGTG...CAGGTTCTCCCTTCG

   1450     .    :    .    :    .    :    .    :    .    :
   1597 CCCGAGCCAGCATTAAAAGTGCCAAGCTGGAGAACTCGACCTTTTTTCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188916 CCCGAGCCAGCATTAAAAGTGCCAAGCTGGAGAACTCGACCTTTTTTCAC

   1500     .    :    .    :    .    :    .    :    .    :
   1647 AAAAAGGAGAGGAGGATGCGTTTCTACATCCGCCGCATGGTCAAAACTCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188966 AAAAAGGAGAGGAGGATGCGTTTCTACATCCGCCGCATGGTCAAAACTCA

   1550     .    :    .    :    .    :    .    :    .    :
   1697 GGCCTTCTACTGGACTGTACTCAGTTTGGTAGCTCTCAACACGCTGTGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 189016 GGCCTTCTACTGGACTGTACTCAGTTTGGTAGCTCTCAACACGCTGTGTG

   1600     .    :    .    :    .    :    .    :    .    :
   1747 TTGCTATTGTTCACTACAACCAGCCCGAGTGGCTCTCCGACTTCCTTT  
        ||||||||||||||||||||||||||||||||||||||||||||||||>>
 189066 TTGCTATTGTTCACTACAACCAGCCCGAGTGGCTCTCCGACTTCCTTTGT

   1650     .    :    .    :    .    :    .    :    .    :
   1795        ACTATGCAGAATTCATTTTCTTAGGACTCTTTATGTCCGAAAT
        >...>>>|||||||||||||||||||||||||||||||||||||||||||
 189116 G...TAGACTATGCAGAATTCATTTTCTTAGGACTCTTTATGTCCGAAAT

   1700     .    :    .    :    .    :    .    :    .    :
   1838 GTTTATAAAAATGTACGGGCTTGGGACGCGGCCTTACTTCCACTCTTCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 193487 GTTTATAAAAATGTACGGGCTTGGGACGCGGCCTTACTTCCACTCTTCCT

   1750     .    :    .    :    .    :    .    :    .    :
   1888 TCAACTGCTTTGACTGTGGG         GTTATCATTGGGAGCATCTTC
        ||||||||||||||||||||>>>...>>>|||||||||||||||||||||
 193537 TCAACTGCTTTGACTGTGGGGTA...TAGGTTATCATTGGGAGCATCTTC

   1800     .    :    .    :    .    :    .    :    .    :
   1929 GAGGTCATCTGGGCTGTCATAAAACCTGGCACATCCTTTGGAATCAGCGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 197718 GAGGTCATCTGGGCTGTCATAAAACCTGGCACATCCTTTGGAATCAGCGT

   1850     .    :    .    :    .    :    .    :    .    :
   1979 GTTACGAGCCCTCAGGTTATTGCGTATTTTCAAAGTCACAAA        
        ||||||||||||||||||||||||||||||||||||||||||>>>...>>
 197768 GTTACGAGCCCTCAGGTTATTGCGTATTTTCAAAGTCACAAAGTA...CA

   1900     .    :    .    :    .    :    .    :    .    :
   2021  GTACTGGGCATCTCTCAGAAACCTGGTCGTCTCTCTCCTCAACTCCATG
        >|||||||||||||||||||||||||||||||||||||||||||||||||
 197973 GGTACTGGGCATCTCTCAGAAACCTGGTCGTCTCTCTCCTCAACTCCATG

   1950     .    :    .    :    .    :    .    :    .    :
   2070 AAGTCCATCATCAGCCTGTTGTTTCTCCTTTTCCTGTTCATTGTCGTCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 198023 AAGTCCATCATCAGCCTGTTGTTTCTCCTTTTCCTGTTCATTGTCGTCTT

   2000     .    :    .    :    .    :    .    :    .    :
   2120 CGCCCTTTTGGGAATGCAACTCTTCGGCGGCCA         GTTTAATT
        |||||||||||||||||||||||||||||||||>>>...>>>||||||||
 198073 CGCCCTTTTGGGAATGCAACTCTTCGGCGGCCAGTA...CAGGTTTAATT

   2050     .    :    .    :    .    :    .    :    .    :
   2161 TCGATGAAGGGACTCCTCCCACCAACTTCGATACTTTTCCAGCAGCAATA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 198379 TCGATGAAGGGACTCCTCCCACCAACTTCGATACTTTTCCAGCAGCAATA

   2100     .    :    .    :    .    :    .    :    .    :
   2211 ATGACGGTGTTTCAG         ATCCTGACGGGCGAAGACTGGAACGA
        |||||||||||||||>>>...>>>||||||||||||||||||||||||||
 198429 ATGACGGTGTTTCAGGTA...CAGATCCTGACGGGCGAAGACTGGAACGA

   2150     .    :    .    :    .    :    .    :    .    :
   2252 GGTCATGTACGACGGGATCAAGTCTCAGGGGGGCGTGCAGGGCGGCATGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 202367 GGTCATGTACGACGGGATCAAGTCTCAGGGGGGCGTGCAGGGCGGCATGG

   2200     .    :    .    :    .    :    .    :    .    :
   2302 TGTTCTCCATCTATTTCATTGTACTGACGCTCTTTGGGAACT        
        ||||||||||||||||||||||||||||||||||||||||||>>>...>>
 202417 TGTTCTCCATCTATTTCATTGTACTGACGCTCTTTGGGAACTGTA...CA

   2250     .    :    .    :    .    :    .    :    .    :
   2344  ACACCCTCCTGAATGTGTTCTTGGCCATCGCTGTGGACAATCTGGCCAA
        >|||||||||||||||||||||||||||||||||||||||||||||||||
 202611 GACACCCTCCTGAATGTGTTCTTGGCCATCGCTGTGGACAATCTGGCCAA

   2300     .    :    .    :    .    :    .    :    .    :
   2393 CGCCCAGGAGCTCACCAAGGTGGAGGCG         GACGAGCAAGAGG
        ||||||||||||||||||||||||||||>>>...>>>|||||||||||||
 202661 CGCCCAGGAGCTCACCAAGGTGGAGGCGGTG...TAGGACGAGCAAGAGG

   2350     .    :    .    :    .    :    .    :    .    :
   2434 AAGAAGAAGCAGCGAACCAGAAACTTGCCCTACAGAAAGCCAAGGAGGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 205582 AAGAAGAAGCAGCGAACCAGAAACTTGCCCTACAGAAAGCCAAGGAGGTG

   2400     .    :    .    :    .    :    .    :    .    :
   2484 GCAGAAGTGAGTCCTCTGTCCGCGGCCAACATGTCTATAGCTGT      
        ||||||||||||||||||||||||||||||||||||||||||||>>>...
 205632 GCAGAAGTGAGTCCTCTGTCCGCGGCCAACATGTCTATAGCTGTGTA...

   2450     .    :    .    :    .    :    .    :    .    :
   2528    GAAAGAGCAACAGAAGAATCAAAAGCCAGCCAAGTCCGTGTGGGAGC
        >>>|||||||||||||||||||||||||||||||||||||||||||||||
 206869 CAGGAAAGAGCAACAGAAGAATCAAAAGCCAGCCAAGTCCGTGTGGGAGC

   2500     .    :    .    :    .    :    .    :    .    :
   2575 AGCGGACCAGTGAGATGCGAAAGCAGAACTTGCTGGCCAGCCGGGAGGCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 206919 AGCGGACCAGTGAGATGCGAAAGCAGAACTTGCTGGCCAGCCGGGAGGCC

   2550     .    :    .    :    .    :    .    :    .    :
   2625 CTGTATAACGAAATGGACCCGGACGAGCGCTGGAAGGCTGCCTACACGCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 206969 CTGTATAACGAAATGGACCCGGACGAGCGCTGGAAGGCTGCCTACACGCG

   2600     .    :    .    :    .    :    .    :    .    :
   2675 GCACCTGCGGCCAGACATGAAGACGCACTTGGACCGGCCGCTGGTGGTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207019 GCACCTGCGGCCAGACATGAAGACGCACTTGGACCGGCCGCTGGTGGTGG

   2650     .    :    .    :    .    :    .    :    .    :
   2725 ACCCGCAGGAGAACCGCAACAACAACACCAACAAGAGCCGGGCGGCCGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207069 ACCCGCAGGAGAACCGCAACAACAACACCAACAAGAGCCGGGCGGCCGAG

   2700     .    :    .    :    .    :    .    :    .    :
   2775 CCCACCGTGGACCAGCGCCTCGGCCAGCAGCGCGCCGAGGACTTCCTCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207119 CCCACCGTGGACCAGCGCCTCGGCCAGCAGCGCGCCGAGGACTTCCTCAG

   2750     .    :    .    :    .    :    .    :    .    :
   2825 GAAACAGGCCCGCTACCACGATCGGGCCCGGGACCCCAGCGGCTCGGCGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207169 GAAACAGGCCCGCTACCACGATCGGGCCCGGGACCCCAGCGGCTCGGCGG

   2800     .    :    .    :    .    :    .    :    .    :
   2875 GCCTGGACGCACGGAGGCCCTGGGCGGGAAGCCAGGAGGCCGAGCTGAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207219 GCCTGGACGCACGGAGGCCCTGGGCGGGAAGCCAGGAGGCCGAGCTGAGC

   2850     .    :    .    :    .    :    .    :    .    :
   2925 CGGGAGGGACCCTACGGCCGCGAGTCGGACCACCACGCCCGGGAGGGCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207269 CGGGAGGGACCCTACGGCCGCGAGTCGGACCACCACGCCCGGGAGGGCAG

   2900     .    :    .    :    .    :    .    :    .    :
   2975 CCTGGAGCAACCCGGGTTCTGGGAGGGCGAGGCCGAGCGAGGCAAGGCCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207319 CCTGGAGCAACCCGGGTTCTGGGAGGGCGAGGCCGAGCGAGGCAAGGCCG

   2950     .    :    .    :    .    :    .    :    .    :
   3025 GGGACCCCCACCGGAGGCACGTGCACCGGCAGGGGGGCAGCAGGGAGAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207369 GGGACCCCCACCGGAGGCACGTGCACCGGCAGGGGGGCAGCAGGGAGAGC

   3000     .    :    .    :    .    :    .    :    .    :
   3075 CGCAGCGGGTCCCCGCGCACGGGCGCGGACGGGGAGCATCGACGTCATCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207419 CGCAGCGGGTCCCCGCGCACGGGCGCGGACGGGGAGCATCGACGTCATCG

   3050     .    :    .    :    .    :    .    :    .    :
   3125 CGCGCACCGCAGGCCCGGGGAGGAGGGTCCGGAGGACAAGGCGGAGCGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207469 CGCGCACCGCAGGCCCGGGGAGGAGGGTCCGGAGGACAAGGCGGAGCGGA

   3100     .    :    .    :    .    :    .    :    .    :
   3175 GGGCGCGGCACCGCGAGGGCAGCCGGCCGGCCCGGGGCGGCGAGGGCGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207519 GGGCGCGGCACCGCGAGGGCAGCCGGCCGGCCCGGGGCGGCGAGGGCGAG

   3150     .    :    .    :    .    :    .    :    .    :
   3225 GGCGAGGGCCCCGACGGGGGCGAGCGCAGGAGAAGGCACCGGCATGGCGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207569 GGCGAGGGCCCCGACGGGGGCGAGCGCAGGAGAAGGCACCGGCATGGCGC

   3200     .    :    .    :    .    :    .    :    .    :
   3275 TCCAGCCACGTACGAGGGGGACGCGCGGAGGGAGGACAAGGAGCGGAGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207619 TCCAGCCACGTACGAGGGGGACGCGCGGAGGGAGGACAAGGAGCGGAGGC

   3250     .    :    .    :    .    :    .    :    .    :
   3325 ATCGGAGGAGGAA         AGAGAACCAGGGCTCCGGGGTCCCTGTG
        |||||||||||||>>>...>>>||||||||||||||||||||||||||||
 207669 ATCGGAGGAGGAAGTA...CAGAGAGAACCAGGGCTCCGGGGTCCCTGTG

   3300     .    :    .    :    .    :    .    :    .    :
   3366 TCGGGCCCCAACCTGTCAACCACCCGGCCAATCCAGCAGGACCTGGGCCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219287 TCGGGCCCCAACCTGTCAACCACCCGGCCAATCCAGCAGGACCTGGGCCG

   3350     .    :    .    :    .    :    .    :    .    :
   3416 CCAAGACCCACCCCTGGCAGAGGATATTGACAACATGAAGAACAACAAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219337 CCAAGACCCACCCCTGGCAGAGGATATTGACAACATGAAGAACAACAAGC

   3400     .    :    .    :    .    :    .    :    .    :
   3466 TGGCCACCGCGGAGTCGGCCGCTCCCCACGGCAGCCTTGGCCACGCCGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219387 TGGCCACCGCGGAGTCGGCCGCTCCCCACGGCAGCCTTGGCCACGCCGGC

   3450     .    :    .    :    .    :    .    :    .    :
   3516 CTGCCCCAGAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219437 CTGCCCCAGAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCAT

   3500     .    :    .    :    .    :    .    :    .    :
   3566 GCTGGCCATCCCTGCCATGGCCACCAACCCCCAGAACGCCGCCAGCCGCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219487 GCTGGCCATCCCTGCCATGGCCACCAACCCCCAGAACGCCGCCAGCCGCC

   3550     .    :    .    :    .    :    .    :    .    :
   3616 GGACGCCCAACAACCCGGGGAACCCATCCAATCCCGGCCCCCCCAAGACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219537 GGACGCCCAACAACCCGGGGAACCCATCCAATCCCGGCCCCCCCAAGACC

   3600     .    :    .    :    .    :    .    :    .    :
   3666 CCCGAGAATAGCCTTATCGTCACCAACCCCAGCGGCACCCAGACCAATTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219587 CCCGAGAATAGCCTTATCGTCACCAACCCCAGCGGCACCCAGACCAATTC

   3650     .    :    .    :    .    :    .    :    .    :
   3716 AGCTAAGACTGCCAGGAAACCCGACCACACCACAGTGGACATCCCCCCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219637 AGCTAAGACTGCCAGGAAACCCGACCACACCACAGTGGACATCCCCCCAG

   3700     .    :    .    :    .    :    .    :    .    :
   3766 CCTGCCCACCCCCCCTCAACCACACCGTCGTACAAG         TGAAC
        ||||||||||||||||||||||||||||||||||||>>>...>>>|||||
 219687 CCTGCCCACCCCCCCTCAACCACACCGTCGTACAAGGTG...CAGTGAAC

   3750     .    :    .    :    .    :    .    :    .    :
   3807 AAAAACGCCAACCCAGACCCACTGCCAAAAAAAGAGGAAGAGAAGAAGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 221024 AAAAACGCCAACCCAGACCCACTGCCAAAAAAAGAGGAAGAGAAGAAGGA

   3800     .    :    .    :    .    :    .    :    .    :
   3857 GGAGGAGGAAGACGACCGTGGGGAAGACGGCCCTAAGCCAATGCCTCCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 221074 GGAGGAGGAAGACGACCGTGGGGAAGACGGCCCTAAGCCAATGCCTCCCT

   3850     .    :    .    :    .    :    .    :    .    :
   3907 ATAGCTCCATGTTCATCCTGTCCACGACCAACCC         CCTTCGC
        ||||||||||||||||||||||||||||||||||>>>...>>>|||||||
 221124 ATAGCTCCATGTTCATCCTGTCCACGACCAACCCGTG...CAGCCTTCGC

   3900     .    :    .    :    .    :    .    :    .    :
   3948 CGCCTGTGCCATTACATCCTGAACCTGCGCTACTTTGAGATGTGCATCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 222836 CGCCTGTGCCATTACATCCTGAACCTGCGCTACTTTGAGATGTGCATCCT

   3950     .    :    .    :    .    :    .    :    .    :
   3998 CATGGTCATTGCCATGAGCAGCATCGCCCTGGCCGCCGAGGACCCTGTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 222886 CATGGTCATTGCCATGAGCAGCATCGCCCTGGCCGCCGAGGACCCTGTGC

   4000     .    :    .    :    .    :    .    :    .    :
   4048 AGCCCAACGCACCTCGGAACAAC         GTGCTGCGATACTTTGAC
        |||||||||||||||||||||||>>>...>>>||||||||||||||||||
 222936 AGCCCAACGCACCTCGGAACAACGTG...CAGGTGCTGCGATACTTTGAC

   4050     .    :    .    :    .    :    .    :    .    :
   4089 TACGTTTTTACAGGCGTCTTCACCTTTGAGATGGTGATCAAG        
        |||||||||||||||||||| |||||||||||||||||||||>>>...>>
 229115 TACGTTTTTACAGGCGTCTTTACCTTTGAGATGGTGATCAAGGTG...CA

   4100     .    :    .    :    .    :    .    :    .    :
   4131  ATGATTGACCTGGGGCTCGTCCTGCATCAGGGTGCCTACTTCCGTGACC
        >|||||||||||||||||||||||||||||||||||||||||||||||||
 230268 GATGATTGACCTGGGGCTCGTCCTGCATCAGGGTGCCTACTTCCGTGACC

   4150     .    :    .    :    .    :    .    :    .    :
   4180 TCTGGAATATTCTCGACTTCATAGTGGTCAGTGGGGCCCTGGTAGCCTTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 230318 TCTGGAATATTCTCGACTTCATAGTGGTCAGTGGGGCCCTGGTAGCCTTT

   4200     .    :    .    :    .    :    .    :    .    :
   4230 GCCTTCAC         TGGCAATAGCAAAGGAAAAGACATCAACACGAT
        ||||||||>>>...>>>|||||||||||||||||||||||||||||||||
 230368 GCCTTCACGTA...CAGTGGCAATAGCAAAGGAAAAGACATCAACACGAT

   4250     .    :    .    :    .    :    .    :    .    :
   4271 TAAATCCCTCCGAGTCCTCCGGGTGCTACGACCTCTTAAAACCATCAAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 243425 TAAATCCCTCCGAGTCCTCCGGGTGCTACGACCTCTTAAAACCATCAAGC

   4300     .    :    .    :    .    :    .    :    .    :
   4321 GGCTGCCAAAGCTCAAG         GCTGTGTTTGACTGTGTGGTGAAC
        |||||||||||||||||>>>...>>>||||||||||||||||||||||||
 243475 GGCTGCCAAAGCTCAAGGTG...CAGGCTGTGTTTGACTGTGTGGTGAAC

   4350     .    :    .    :    .    :    .    :    .    :
   4362 TCACTTAAAAACGTCTTCAACATCCTCATCGTCTACATGCTATTCATGTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 244639 TCACTTAAAAACGTCTTCAACATCCTCATCGTCTACATGCTATTCATGTT

   4400     .    :    .    :    .    :    .    :    .    :
   4412 CATCTTCGCCGTGGTGGCTGTGCAGCTCTTCAAGGGGAAATTCTTCCACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 244689 CATCTTCGCCGTGGTGGCTGTGCAGCTCTTCAAGGGGAAATTCTTCCACT

   4450     .    :    .    :    .    :    .    :    .    :
   4462 GCACTGACGAGTCCAAAGAGTTTGAGAAAGATTGTCG         AGGC
        |||||||||||||||||||||||||||||||||||||>>>...>>>||||
 244739 GCACTGACGAGTCCAAAGAGTTTGAGAAAGATTGTCGGTG...CAGAGGC

   4500     .    :    .    :    .    :    .    :    .    :
   4503 AAATACCTCCTCTACGAGAAGAATGAGGTGAAGGCGCGAGACCGGGAGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 246528 AAATACCTCCTCTACGAGAAGAATGAGGTGAAGGCGCGAGACCGGGAGTG

   4550     .    :    .    :    .    :    .    :    .    :
   4553 GAAGAAGTATGAATTCCATTACGACAATGTGCTGTGGGCTCTGCTGACCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 246578 GAAGAAGTATGAATTCCATTACGACAATGTGCTGTGGGCTCTGCTGACCC

   4600     .    :    .    :    .    :    .    :    .    :
   4603 TCTTCACCGTGTCCACGGGAGAAGGCTGGCCACA         GGTCCTC
        ||||||||||||||||||||||||||||||||||>>>...>>>|||||||
 246628 TCTTCACCGTGTCCACGGGAGAAGGCTGGCCACAGTA...CAGGGTCCTC

   4650     .    :    .    :    .    :    .    :    .    :
   4644 AAGCATTCGGTGGACGCCACCTTTGAGAACCAGGGCCCCAGCCCCGGGTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 248681 AAGCATTCGGTGGACGCCACCTTTGAGAACCAGGGCCCCAGCCCCGGGTA

   4700     .    :    .    :    .    :    .    :    .    :
   4694 CCGCATGGAGATGTCCATTTTCTACGTCGTCTACTTTGTGGTGTTCCCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 248731 CCGCATGGAGATGTCCATTTTCTACGTCGTCTACTTTGTGGTGTTCCCCT

   4750     .    :    .    :    .    :    .    :    .    :
   4744 TCTTCTTTGTCAATATCTTTGTGGCCTTGATCATCATCACCTTCCAGGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 248781 TCTTCTTTGTCAATATCTTTGTGGCCTTGATCATCATCACCTTCCAGGAG

   4800     .    :    .    :    .    :    .    :    .    :
   4794 CAAGGGGACAAGATGATGGAGGAATACAGCCTGGAGAAAAATGAG     
        |||||||||||||||||||||||||||||||||||||||||||||>>>..
 248831 CAAGGGGACAAGATGATGGAGGAATACAGCCTGGAGAAAAATGAGGTG..

   4850     .    :    .    :    .    :    .    :    .    :
   4839     AGGGCCTGCATTGATTTCGCCATCAGCGCCAAGCCGCTGACCCGAC
        .>>>||||||||||||||||||||||||||||||||||||||||||||||
 248881 .CAGAGGGCCTGCATTGATTTCGCCATCAGCGCCAAGCCGCTGACCCGAC

   4900     .    :    .    :    .    :    .    :    .    :
   4885 ACATGCCGCAGAACAAGCAGAGCTTCCAGTACCGCATGTGGCAGTTCGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 251012 ACATGCCGCAGAACAAGCAGAGCTTCCAGTACCGCATGTGGCAGTTCGTG

   4950     .    :    .    :    .    :    .    :    .    :
   4935 GTGTCTCCGCCTTTCGAGTACACGATCATGGCCATGATCGCCCTCAACAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 251062 GTGTCTCCGCCTTTCGAGTACACGATCATGGCCATGATCGCCCTCAACAC

   5000     .    :    .    :    .    :    .    :    .    :
   4985 CATCGTGCTTATGATGAAG         TTCTATGGGGCTTCTGTTGCTT
        |||||||||||||||||||>>>...>>>||||||||||||||||||||||
 251112 CATCGTGCTTATGATGAAGGTA...TAGTTCTATGGGGCTTCTGTTGCTT

   5050     .    :    .    :    .    :    .    :    .    :
   5026 ATGAAAATGCCCTGCGGGTGTTCAACATCGTCTTCACCTCCCTCTTCTCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 253146 ATGAAAATGCCCTGCGGGTGTTCAACATCGTCTTCACCTCCCTCTTCTCT

   5100     .    :    .    :    .    :    .    :    .    :
   5076 CTGGAATGTGTGCTGAAAGTCATGGCTTTTGGGATTCTG         AA
        |||||||||||||||||||||||||||||||||||||||>>>...>>>||
 253196 CTGGAATGTGTGCTGAAAGTCATGGCTTTTGGGATTCTGGTA...TAGAA

   5150     .    :    .    :    .    :    .    :    .    :
   5117 TTATTTCCGCGATGCCTGGAACATCTTCGACTTTGTGACTGTTCTGGGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 260962 TTATTTCCGCGATGCCTGGAACATCTTCGACTTTGTGACTGTTCTGGGCA

   5200     .    :    .    :    .    :    .    :    .    :
   5167 GCATCACCGATATCCTCGTGACTGAGTTTGGGAATCCG         AAT
        |||||||||||||||||||||||||||||||| -|  ->>>...>>>|||
 261012 GCATCACCGATATCCTCGTGACTGAGTTTGGGG TAA GTC...CAGAAT

   5250     .    :    .    :    .    :    .    :    .    :
   5208 AACTTCATCAACCTGAGCTTTCTCCGCCTCTTCCGAGCTGCCCGGCTCAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 270498 AACTTCATCAACCTGAGCTTTCTCCGCCTCTTCCGAGCTGCCCGGCTCAT

   5300     .    :    .    :    .    :    .    :    .    :
   5258 CAAACTTCTCCGTCAGGGTTACACCATCCGCATTCTTCTCTGGACCTTTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 270548 CAAACTTCTCCGTCAGGGTTACACCATCCGCATTCTTCTCTGGACCTTTG

   5350     .    :    .    :    .    :    .    :    .    :
   5308 TGCAGTCCTTCAAG         GCCCTGCCTTATGTCTGTCTGCTGATC
        ||||||||||||||>>>...>>>|||||||||||||||||||||||||||
 270598 TGCAGTCCTTCAAGGTG...CAGGCCCTGCCTTATGTCTGTCTGCTGATC

   5400     .    :    .    :    .    :    .    :    .    :
   5349 GCCATGCTCTTCTTCATCTATGCCATCATTGGGATGCAG         GT
        |||||||||||||||||||||||||||||||||||||||>>>...>>>||
 270978 GCCATGCTCTTCTTCATCTATGCCATCATTGGGATGCAGGTG...CAGGT

   5450     .    :    .    :    .    :    .    :    .    :
   5390 GTTTGGTAACATTGGCATCGACGTGGAGGACGAGGACAGTGATGAAGATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 271191 GTTTGGTAACATTGGCATCGACGTGGAGGACGAGGACAGTGATGAAGATG

   5500     .    :    .    :    .    :    .    :    .    :
   5440 AGTTCCAAATCACTGAGCACAATAACTTCCGGACCTTCTTCCAGGCCCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 271241 AGTTCCAAATCACTGAGCACAATAACTTCCGGACCTTCTTCCAGGCCCTC

   5550     .    :    .    :    .    :    .    :    .    :
   5490 ATGCTTCTCTTCCG         GAGTGCCACCGGGGAAGCTTGGCACAA
        ||||||||||||||>>>...>>>|||||||||||||||||||||||||||
 271291 ATGCTTCTCTTCCGGTG...CAGGAGTGCCACCGGGGAAGCTTGGCACAA

   5600     .    :    .    :    .    :    .    :    .    :
   5531 CATCATGCTTTCCTGCCTCAGCGGGAAACCGTGTGATAAGAACTCTGGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 274392 CATCATGCTTTCCTGCCTCAGCGGGAAACCGTGTGATAAGAACTCTGGCA

   5650     .    :    .    :    .    :    .    :    .    :
   5581 TCCTGACTCGAGAGTGTGGCAATGAATTTGCTTATTTTTACTTTGTTTCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 274442 TCCTGACTCGAGAGTGTGGCAATGAATTTGCTTATTTTTACTTTGTTTCC

   5700     .    :    .    :    .    :    .    :    .    :
   5631 TTCATCTTCCTCTGCTCGTTTCTG         ATGCTGAATCTCTTTGT
        ||||||||||||||||||||||||>>>...>>>|||||||||||||||||
 274492 TTCATCTTCCTCTGCTCGTTTCTGGTG...CAGATGCTGAATCTCTTTGT

   5750     .    :    .    :    .    :    .    :    .    :
   5672 CGCCGTCATCATGGACAACTTTGAGTACCTCACCCGAGACTCCTCCATCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 276033 CGCCGTCATCATGGACAACTTTGAGTACCTCACCCGAGACTCCTCCATCC

   5800     .    :    .    :    .    :    .    :    .    :
   5722 TGGGCCCCCACCACCTGGATGAGTACGTGCGTGTCTGGGCCGAGTATGAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 276083 TGGGCCCCCACCACCTGGATGAGTACGTGCGTGTCTGGGCCGAGTATGAC

   5850     .    :    .    :    .    :    .    :    .    :
   5772 CCCGCAGCTTG         GGGCCGCATGCCTTACCTGGACATGTATCA
        |||||||||||>>>...>>>||||||||||||||||||||||||||||||
 276133 CCCGCAGCTTGGTA...CAGGGGCCGCATGCCTTACCTGGACATGTATCA

   5900     .    :    .    :    .    :    .    :    .    :
   5813 GATGCTGAGACACATGTCTCCGCCCCTGGGTCTGGGGAAGAAGTGTCCGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 278728 GATGCTGAGACACATGTCTCCGCCCCTGGGTCTGGGGAAGAAGTGTCCGG

   5950     .    :    .    :    .    :    .    :    .    :
   5863 CCAGAGTGGCTTACAAG         CGGCTTCTGCGGATGGACCTGCCC
        |||||||||||||||||>>>...>>>||||||||||||||||||||||||
 278778 CCAGAGTGGCTTACAAGGTA...TAGCGGCTTCTGCGGATGGACCTGCCC

   6000     .    :    .    :    .    :    .    :    .    :
   5904 GTCGCAGATGACAACACCGTCCACTTCAATTCCACCCTCATGGCTCTGAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 281477 GTCGCAGATGACAACACCGTCCACTTCAATTCCACCCTCATGGCTCTGAT

   6050     .    :    .    :    .    :    .    :    .    :
   5954 CCGCACAGCCCTGGACATCAAGATTGCCAAGG         GAGGAGCCG
        ||||||||||||||||||||||||||||||||>>>...>>>|||||||||
 281527 CCGCACAGCCCTGGACATCAAGATTGCCAAGGGTA...CAGGAGGAGCCG

   6100     .    :    .    :    .    :    .    :    .    :
   5995 ACAAACAGCAGATGGACGCTGAGCTGCGGAAGGAGATGATGGCGATTTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 291626 ACAAACAGCAGATGGACGCTGAGCTGCGGAAGGAGATGATGGCGATTTGG

   6150     .    :    .    :    .    :    .    :    .    :
   6045 CCCAATCTGTCCCAGAAGACGCTAGACCTGCTGGTCACACCTCACAAGT 
        |||||||||||||||||||||||||||||||||||||||||||||||||>
 291676 CCCAATCTGTCCCAGAAGACGCTAGACCTGCTGGTCACACCTCACAAGTG

   6200     .    :    .    :    .    :    .    :    .    :
   6094         CCACGGACCTCACCGTGGGGAAGATCTACGCAGCCATGATGA
        >>...>>>||||||||||||||||||||||||||||||||||||||||||
 291726 TA...CAGCCACGGACCTCACCGTGGGGAAGATCTACGCAGCCATGATGA

   6250     .    :    .    :    .    :    .    :    .    :
   6136 TCATGGAGTACTACCGGCAGAGCAAGGCCAAGAAGCTGCAGGCCATGCGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 291934 TCATGGAGTACTACCGGCAGAGCAAGGCCAAGAAGCTGCAGGCCATGCGC

   6300     .    :    .    :    .    :    .    :    .    :
   6186 GAGGAGCAG         GACCGGACACCCCTCATGTTCCAGCGCATGGA
        |||||||||>>>...>>>||||||||||||||||||||||||||||||||
 291984 GAGGAGCAGGTG...CAGGACCGGACACCCCTCATGTTCCAGCGCATGGA

   6350     .    :    .    :    .    :    .    :    .    :
   6227 GCCCCCGTCCCCAACGCAGGAAGGGGGACCTGGCCAGAACGCCCTCCCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 293517 GCCCCCGTCCCCAACGCAGGAAGGGGGACCTGGCCAGAACGCCCTCCCCT

   6400     .    :    .    :    .    :    .    :    .    :
   6277 CCACCCAGCTGGACCCAGGAGGAGCCCT         GATGGCTCACGAA
        ||||||||||||||||||||||||||||>>>...>>>|||||||||||||
 293567 CCACCCAGCTGGACCCAGGAGGAGCCCTGTG...CAGGATGGCTCACGAA

   6450     .    :    .    :    .    :    .    :    .    :
   6318 AGCGGCCTCAAGGAGAGCCCGTCCTGGGTGACCCAGCGTGCCCAGGAGAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 293716 AGCGGCCTCAAGGAGAGCCCGTCCTGGGTGACCCAGCGTGCCCAGGAGAT

   6500     .    :    .    :    .    :    .    :    .    :
   6368 GTTCCAGAAGACGGGCACATGGAGTCCGGAACAAGGCCCCCCTACCGACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 293766 GTTCCAGAAGACGGGCACATGGAGTCCGGAACAAGGCCCCCCTACCGACA

   6550     .    :    .    :    .    :    .    :    .    :
   6418 TGCCCAACAGCCAGCCTAACTCTCAG         TCCGTGGAGATGCGA
        ||||||||||||||||||||||||||>>>...>>>|||||||||||||||
 293816 TGCCCAACAGCCAGCCTAACTCTCAGGTG...CAGTCCGTGGAGATGCGA

   6600     .    :    .    :    .    :    .    :    .    :
   6459 GAGATGGGCAGAGATGGCTACTCCGACAGCGAGCACTACCTCCCCATGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 294024 GAGATGGGCAGAGATGGCTACTCCGACAGCGAGCACTACCTCCCCATGGA

   6650     .    :    .    :    .    :    .    :    .    :
   6509 AGGCCAGGGCCGGGCTGCCTCCATGCCCCGCCTCCCTGCAGAGAACCAG 
        |||||||||||||||||||||||||||||||||||||||||||||||||>
 294074 AGGCCAGGGCCGGGCTGCCTCCATGCCCCGCCTCCCTGCAGAGAACCAGG

   6700     .    :    .    :    .    :    .    :    .    :
   6558         AGGAGAAGGGGCCGGCCACGTGGGAATAACCTCAGT      
        >>...>>>||||||||||||||||||||||||||||||||||||>>>...
 294124 TG...CAGAGGAGAAGGGGCCGGCCACGTGGGAATAACCTCAGTGTA...

   6750     .    :    .    :    .    :    .    :    .    :
   6594    ACCATCTCAGACACCAGCCCCATGAAGCGTTCAGCCTCCGTGCTGGG
        >>>|||||||||||||||||||||||||||||||||||||||||||||||
 296724 CAGACCATCTCAGACACCAGCCCCATGAAGCGTTCAGCCTCCGTGCTGGG

   6800     .    :    .    :    .    :    .    :    .    :
   6641 CCCCAAGGCCCGACGCCTGGACGATTACTCGCTGGAGCGGGTCCCGCCCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 296774 CCCCAAGGCCCGACGCCTGGACGATTACTCGCTGGAGCGGGTCCCGCCCG

   6850     .    :    .    :    .    :    .    :    .    :
   6691 AGGAGAACCAGCGGCACCACCAGCGGCGCCGCGACCGCAGCCACCGCGCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 296824 AGGAGAACCAGCGGCACCACCAGCGGCGCCGCGACCGCAGCCACCGCGCC

   6900     .    :    .    :    .    :    .    :    .    :
   6741 TCTGAGCGCTCCCTGGGCCGCTACACCGATGTGGACACAG         G
        ||||||||||||||||||||||||||||||||||||||||>>>...>>>|
 296874 TCTGAGCGCTCCCTGGGCCGCTACACCGATGTGGACACAGGTG...CAGG

   6950     .    :    .    :    .    :    .    :    .    :
   6782 CTTGGGGACAGACCTGAGCATGACCACCCAATCCGGGGACCTGCCGTCGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 297217 CTTGGGGACAGACCTGAGCATGACCACCCAATCCGGGGACCTGCCGTCGA

   7000     .    :    .    :    .    :    .    :    .    :
   6832 AGGAGCGGGACCAGGAGCGGGGCCGGCCCAAGGATCGGAAGCATCGACAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 297267 AGGAGCGGGACCAGGAGCGGGGCCGGCCCAAGGATCGGAAGCATCGACAG

   7050     .    :    .    :    .    :    .    :    .    :
   6882 CACCACCACCACCACCACCACCACCACCATCCCCCGCCCCCCGACAAGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 297317 CACCACCACCACCACCACCACCACCACCATCCCCCGCCCCCCGACAAGGA

   7100     .    :    .    :    .    :    .    :    .    :
   6932 CCGCTATGCCCAGGAACGGCCGGACCACGGCCGGGCACGGGCTCGGGACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 297367 CCGCTATGCCCAGGAACGGCCGGACCACGGCCGGGCACGGGCTCGGGACC

   7150     .    :    .    :    .    :    .    :    .    :
   6982 AGCGCTGGTCCCGCTCGCCCAGCGAGGGCCGAGAGCACATGGCGCACCGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 297417 AGCGCTGGTCCCGCTCGCCCAGCGAGGGCCGAGAGCACATGGCGCACCGG

   7200     .    :    .    :    .    :    .    :    .    :
   7032 CAG         TAGTTCCGTAAGTGGAAGCCCAGCCCCCTCAACATCTG
        |||>>>...>>>||||||||||||||||||||||||||||||||||||||
 297467 CAGGTG...CAGTAGTTCCGTAAGTGGAAGCCCAGCCCCCTCAACATCTG

   7250     .    :    .    :    .    :    .    :    .    :
   7073 GTACCAGCACTCCGCGGCGGGGCCGCCGCCAGCTCCCCCAGACCCCCTCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298215 GTACCAGCACTCCGCGGCGGGGCCGCCGCCAGCTCCCCCAGACCCCCTCC

   7300     .    :    .    :    .    :    .    :    .    :
   7123 ACCCCCCGGCCACACGTGTCCTATTCCCCTGTGATCCGTAAGGCCGGCGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298265 ACCCCCCGGCCACACGTGTCCTATTCCCCTGTGATCCGTAAGGCCGGCGG

   7350     .    :    .    :    .    :    .    :    .    :
   7173 CTCGGG         GC  C  C  C  C GCAGCAGCAGCAGCAGCAGC
        ||||||---------||--|--|--|--|-||||||||||||||||||||
 298315 CTCGGGGCCCCCGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC

   7400     .    :    .    :    .    :    .    :    .    :
   7205 AGGCGGTGGCCAGGCCGGGCCGGGCGGCCACCAGCGGCCCTCGGAGGTAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298365 AGGCGGTGGCCAGGCCGGGCCGGGCGGCCACCAGCGGCCCTCGGAGGTAC

   7450     .    :    .    :    .    :    .    :    .    :
   7255 CCAGGCCCCACGGCCGAGCCTCTGGCCGGAGATCGGCCGCCCACGGGGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298415 CCAGGCCCCACGGCCGAGCCTCTGGCCGGAGATCGGCCGCCCACGGGGGG

   7500     .    :    .    :    .    :    .    :    .    :
   7305 CCACAGCAGCGGCCGCTCGCCCAGGATGGAGAGGCGGGTCCCAGGCCCGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298465 CCACAGCAGCGGCCGCTCGCCCAGGATGGAGAGGCGGGTCCCAGGCCCGG

   7550     .    :    .    :    .    :    .    :    .    :
   7355 CCCGGAGCGAGTCCCCCAGGGCCTGTCGACACGGCGGGGCCCGGTGGCCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298515 CCCGGAGCGAGTCCCCCAGGGCCTGTCGACACGGCGGGGCCCGGTGGCCG

   7600     .    :    .    :    .    :    .    :    .    :
   7405 GCATCTGGCCCGCACGTGTCCGAGGGGCCCCCGGGTCCCCGGCACCATGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298565 GCATCTGGCCCGCACGTGTCCGAGGGGCCCCCGGGTCCCCGGCACCATGG

   7650     .    :    .    :    .    :    .    :    .    :
   7455 CTACTACCGGGGCTCCGACTACGACGAGGCCGATGGCCCGGGCAGCGGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298615 CTACTACCGGGGCTCCGACTACGACGAGGCCGATGGCCCGGGCAGCGGGG

   7700     .    :    .    :    .    :    .    :    .    :
   7505 GCGGCGAGGAGGCCATGGCCGGGGCCTACGACGCGCCACCCCCCGTACGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298665 GCGGCGAGGAGGCCATGGCCGGGGCCTACGACGCGCCACCCCCCGTACGA

   7750     .    :    .    :    .    :    .    :    .    :
   7555 CACGCGTCCTCGGGCGCCACCGGGCGCTCGCCCAGGACTCCCCGGGCCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298715 CACGCGTCCTCGGGCGCCACCGGGCGCTCGCCCAGGACTCCCCGGGCCTC

   7800     .    :    .    :    .    :    .    :    .    :
   7605 GGGCCCGGCCTGCGCCTCGCCTTCTCGGCACGGCCGGCGACTCCCCAACG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298765 GGGCCCGGCCTGCGCCTCGCCTTCTCGGCACGGCCGGCGACTCCCCAACG

   7850     .    :    .    :    .    :    .    :    .    :
   7655 GCTACTACCCGGCGCACGGACTGGCCAGGCCCCGCGGGCCGGGCTCCAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298815 GCTACTACCCGGCGCACGGACTGGCCAGGCCCCGCGGGCCGGGCTCCAGG

   7900     .    :    .    :    .    :    .    :    .    :
   7705 AAGGGCCTGCACGAACCCTACAGCGAGAGTGACGATGATTGGTGCTAAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298865 AAGGGCCTGCACGAACCCTACAGCGAGAGTGACGATGATTGGTGCTAAGC

   7950     .    :
   7755 CCGGGCGAGG
        ||||||||||
 298915 CCGGGCGAGG

END