Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AB035727.2
Subject Sequence ID: ENSG00000141837
Subject Sequence type: 2


seq1 = /RAID/mart2/Splice/web_temp/fasta/AB035727.2, 7521 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000141837 (ENSG00000141837), 298924 bp

>gi|9711928|dbj|AB035727.2| Homo sapiens CACNA1A mRNA for alpha1A-voltage-dependent calcium channel, complete cds, isolate:TMDN-CNT-001
>ENSG00000141837

(complement)

1-293  (1-293)   100% ->
294-399  (51013-51118)   100% ->
400-539  (53210-53349)   100% ->
540-631  (134446-134537)   100% ->
632-784  (140756-140908)   100% ->
785-978  (146426-146619)   99% ->
979-1082  (170316-170419)   100% ->
1083-1198  (171732-171847)   99% ->
1199-1255  (173300-173356)   100% ->
1256-1345  (175892-175981)   100% ->
1346-1555  (188904-189113)   100% ->
1556-1668  (193444-193556)   100% ->
1669-1781  (197697-197809)   100% ->
1782-1913  (197974-198105)   100% ->
1914-1986  (198371-198443)   100% ->
1987-2104  (202341-202458)   99% ->
2105-2172  (202612-202679)   100% ->
2173-2279  (205569-205675)   100% ->
2280-3089  (206872-207681)   99% ->
3090-3553  (219259-219722)   99% ->
3554-3692  (221019-221157)   100% ->
3693-3822  (222829-222958)   100% ->
3823-3882  (229097-229156)   100% ->
3883-3989  (230269-230375)   100% ->
3990-4089  (243392-243491)   100% ->
4090-4250  (244615-244775)   100% ->
4251-4388  (246524-246661)   100% ->
4389-4590  (248674-248875)   100% ->
4591-4755  (250966-251130)   100% ->
4756-4866  (253124-253234)   100% ->
4867-4950  (260960-261043)   100% ->
4951-5067  (270495-270611)   100% ->
5068-5133  (270951-271016)   100% ->
5134-5249  (271189-271304)   100% ->
5250-5400  (274365-274515)   100% ->
5401-5528  (276016-276143)   100% ->
5529-5625  (278698-278794)   100% ->
5626-5731  (281453-281558)   100% ->
5732-5839  (291617-291724)   100% ->
5840-5940  (291892-291992)   100% ->
5941-6050  (293485-293594)   100% ->
6051-6189  (293703-293841)   100% ->
6190-6303  (294009-294122)   100% ->
6304-6339  (295573-295608)   100% ->
6340-6526  (296727-296913)   100% ->
6527-6780  (297216-297469)   100% ->
6781-7521  (298172-298912)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 ATGGCCCGCTTCGGAGACGAGATGCCGGCCCGCTACGGGGGAGGAGGCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      1 ATGGCCCGCTTCGGAGACGAGATGCCGGCCCGCTACGGGGGAGGAGGCTC

     50     .    :    .    :    .    :    .    :    .    :
     51 CGGGGCAGCCGCCGGGGTGGTCGTGGGCAGCGGAGGCGGGCGAGGAGCCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     51 CGGGGCAGCCGCCGGGGTGGTCGTGGGCAGCGGAGGCGGGCGAGGAGCCG

    100     .    :    .    :    .    :    .    :    .    :
    101 GGGGCAGCCGGCAGGGCGGGCAGCCCGGGGCGCAAAGGATGTACAAGCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    101 GGGGCAGCCGGCAGGGCGGGCAGCCCGGGGCGCAAAGGATGTACAAGCAG

    150     .    :    .    :    .    :    .    :    .    :
    151 TCAATGGCGCAGAGAGCGCGGACCATGGCACTCTACAACCCCATCCCCGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    151 TCAATGGCGCAGAGAGCGCGGACCATGGCACTCTACAACCCCATCCCCGT

    200     .    :    .    :    .    :    .    :    .    :
    201 CCGACAGAACTGCCTCACGGTTAACCGGTCTCTCTTCCTCTTCAGCGAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    201 CCGACAGAACTGCCTCACGGTTAACCGGTCTCTCTTCCTCTTCAGCGAAG

    250     .    :    .    :    .    :    .    :    .    :
    251 ACAACGTGGTGAGAAAATACGCCAAAAAGATCACCGAATGGCC       
        |||||||||||||||||||||||||||||||||||||||||||>>>...>
    251 ACAACGTGGTGAGAAAATACGCCAAAAAGATCACCGAATGGCCATA...T

    300     .    :    .    :    .    :    .    :    .    :
    294   TCCCTTTGAATATATGATTTTAGCCACCATCATAGCGAATTGCATCGT
        >>||||||||||||||||||||||||||||||||||||||||||||||||
  51011 ACTCCCTTTGAATATATGATTTTAGCCACCATCATAGCGAATTGCATCGT

    350     .    :    .    :    .    :    .    :    .    :
    342 CCTCGCACTGGAGCAGCATCTGCCTGATGATGACAAGACCCCGATGTCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  51061 CCTCGCACTGGAGCAGCATCTGCCTGATGATGACAAGACCCCGATGTCTG

    400     .    :    .    :    .    :    .    :    .    :
    392 AACGGCTG         GATGACACAGAACCATACTTCATTGGAATTTTT
        ||||||||>>>...>>>|||||||||||||||||||||||||||||||||
  51111 AACGGCTGGTG...CAGGATGACACAGAACCATACTTCATTGGAATTTTT

    450     .    :    .    :    .    :    .    :    .    :
    433 TGTTTCGAGGCTGGAATTAAAATCATTGCCCTTGGGTTTGCCTTCCACAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  53243 TGTTTCGAGGCTGGAATTAAAATCATTGCCCTTGGGTTTGCCTTCCACAA

    500     .    :    .    :    .    :    .    :    .    :
    483 AGGCTCCTACTTGAGGAATGGCTGGAATGTCATGGACTTTGTGGTGGTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  53293 AGGCTCCTACTTGAGGAATGGCTGGAATGTCATGGACTTTGTGGTGGTGC

    550     .    :    .    :    .    :    .    :    .    :
    533 TAACGGG         CATCTTGGCGACAGTTGGGACGGAGTTTGACCTA
        |||||||>>>...>>>||||||||||||||||||||||||||||||||||
  53343 TAACGGGGTA...CAGCATCTTGGCGACAGTTGGGACGGAGTTTGACCTA

    600     .    :    .    :    .    :    .    :    .    :
    574 CGGACGCTGAGGGCAGTTCGAGTGCTGCGGCCGCTCAAGCTGGTGTCTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 134480 CGGACGCTGAGGGCAGTTCGAGTGCTGCGGCCGCTCAAGCTGGTGTCTGG

    650     .    :    .    :    .    :    .    :    .    :
    624 AATCCCAA         GTTTACAAGTCGTCCTGAAGTCGATCATGAAGG
        ||||||||>>>...>>>|||||||||||||||||||||||||||||||||
 134530 AATCCCAAGTG...CAGGTTTACAAGTCGTCCTGAAGTCGATCATGAAGG

    700     .    :    .    :    .    :    .    :    .    :
    665 CGATGATCCCTTTGCTGCAGATCGGCCTCCTCCTATTTTTTGCAATCCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 140789 CGATGATCCCTTTGCTGCAGATCGGCCTCCTCCTATTTTTTGCAATCCTT

    750     .    :    .    :    .    :    .    :    .    :
    715 ATTTTTGCAATCATAGGGTTAGAATTTTATATGGGAAAATTTCATACCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 140839 ATTTTTGCAATCATAGGGTTAGAATTTTATATGGGAAAATTTCATACCAC

    800     .    :    .    :    .    :    .    :    .    :
    765 CTGCTTTGAAGAGGGGACAG         ATGACATTCAGGGTGAGTCTC
        ||||||||||||||||||||>>>...>>>|||||||||||||||||||||
 140889 CTGCTTTGAAGAGGGGACAGGTA...TAGATGACATTCAGGGTGAGTCTC

    850     .    :    .    :    .    :    .    :    .    :
    806 CGGCTCCATGTGGGACAGAAGAGCCCGCCCGCACCTGCCCCAATGGGACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 146447 CGGCTCCATGTGGGACAGAAGAGCCCGCCCGCACCTGCCCCAATGGGACC

    900     .    :    .    :    .    :    .    :    .    :
    856 AAATGTCAGCCCTACTGGGAGGGGCCCAACAACGGGATCACTCAGTTCGA
        |||||||||||||||||||| |||||||||||||||||||||||||||||
 146497 AAATGTCAGCCCTACTGGGAAGGGCCCAACAACGGGATCACTCAGTTCGA

    950     .    :    .    :    .    :    .    :    .    :
    906 CAACATCCTGTTTGCAGTGCTGACTGTTTTCCAGTGCATAACCATGGAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 146547 CAACATCCTGTTTGCAGTGCTGACTGTTTTCCAGTGCATAACCATGGAAG

   1000     .    :    .    :    .    :    .    :    .    :
    956 GGTGGACTGATCTCCTCTACAAT         AGCAACGATGCCTCAGGG
        |||||||||||||||||||||||>>>...>>>||||||||||||||||||
 146597 GGTGGACTGATCTCCTCTACAATGTA...CAGAGCAACGATGCCTCAGGG

   1050     .    :    .    :    .    :    .    :    .    :
    997 AACACTTGGAACTGGTTGTACTTCATCCCCCTCATCATCATCGGCTCCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 170334 AACACTTGGAACTGGTTGTACTTCATCCCCCTCATCATCATCGGCTCCTT

   1100     .    :    .    :    .    :    .    :    .    :
   1047 TTTTATGCTGAACCTTGTGCTGGGTGTGCTGTCAGG         GGAGT
        ||||||||||||||||||||||||||||||||||||>>>...>>>|||||
 170384 TTTTATGCTGAACCTTGTGCTGGGTGTGCTGTCAGGGTA...CAGGGAGT

   1150     .    :    .    :    .    :    .    :    .    :
   1088 TTGCCAAAGAAAGGGAACGGGTGGAGAACCGGCGGGCTTTTCTGAAGCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 171737 TTGCCAAAGAAAGGGAACGGGTGGAGAACCGGCGGGCTTTTCTGAAGCTG

   1200     .    :    .    :    .    :    .    :    .    :
   1138 AGGCGGCAACAACAGATTGAACGTGAGCTCAATGGGTACATGGAATGGAT
        |||||||||||||||||||||||||||||||||||||||||||| |||||
 171787 AGGCGGCAACAACAGATTGAACGTGAGCTCAATGGGTACATGGAGTGGAT

   1250     .    :    .    :    .    :    .    :    .    :
   1188 CTCAAAAGCAG         AAGAGGTGATCCTCGCCGAGGATGAAACTG
        |||||||||||>>>...>>>||||||||||||||||||||||||||||||
 171837 CTCAAAAGCAGGTG...CAGAAGAGGTGATCCTCGCCGAGGATGAAACTG

   1300     .    :    .    :    .    :    .    :    .    :
   1229 ACGGGGAGCAGAGGCATCCCTTTGATG         CTCTGCGGAGAACC
        |||||||||||||||||||||||||||>>>...>>>||||||||||||||
 173330 ACGGGGAGCAGAGGCATCCCTTTGATGGTA...GAGCTCTGCGGAGAACC

   1350     .    :    .    :    .    :    .    :    .    :
   1270 ACCATAAAGAAAAGCAAGACAGATTTGCTCAACCCCGAAGAGGCTGAGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 175906 ACCATAAAGAAAAGCAAGACAGATTTGCTCAACCCCGAAGAGGCTGAGGA

   1400     .    :    .    :    .    :    .    :    .    :
   1320 TCAGCTGGCTGATATAGCCTCTGTGG         GTTCTCCCTTCGCCC
        ||||||||||||||||||||||||||>>>...>>>|||||||||||||||
 175956 TCAGCTGGCTGATATAGCCTCTGTGGGTG...CAGGTTCTCCCTTCGCCC

   1450     .    :    .    :    .    :    .    :    .    :
   1361 GAGCCAGCATTAAAAGTGCCAAGCTGGAGAACTCGACCTTTTTTCACAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188919 GAGCCAGCATTAAAAGTGCCAAGCTGGAGAACTCGACCTTTTTTCACAAA

   1500     .    :    .    :    .    :    .    :    .    :
   1411 AAGGAGAGGAGGATGCGTTTCTACATCCGCCGCATGGTCAAAACTCAGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188969 AAGGAGAGGAGGATGCGTTTCTACATCCGCCGCATGGTCAAAACTCAGGC

   1550     .    :    .    :    .    :    .    :    .    :
   1461 CTTCTACTGGACTGTACTCAGTTTGGTAGCTCTCAACACGCTGTGTGTTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 189019 CTTCTACTGGACTGTACTCAGTTTGGTAGCTCTCAACACGCTGTGTGTTG

   1600     .    :    .    :    .    :    .    :    .    :
   1511 CTATTGTTCACTACAACCAGCCCGAGTGGCTCTCCGACTTCCTTT     
        |||||||||||||||||||||||||||||||||||||||||||||>>>..
 189069 CTATTGTTCACTACAACCAGCCCGAGTGGCTCTCCGACTTCCTTTGTG..

   1650     .    :    .    :    .    :    .    :    .    :
   1556     ACTATGCAGAATTCATTTTCTTAGGACTCTTTATGTCCGAAATGTT
        .>>>||||||||||||||||||||||||||||||||||||||||||||||
 189119 .TAGACTATGCAGAATTCATTTTCTTAGGACTCTTTATGTCCGAAATGTT

   1700     .    :    .    :    .    :    .    :    .    :
   1602 TATAAAAATGTACGGGCTTGGGACGCGGCCTTACTTCCACTCTTCCTTCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 193490 TATAAAAATGTACGGGCTTGGGACGCGGCCTTACTTCCACTCTTCCTTCA

   1750     .    :    .    :    .    :    .    :    .    :
   1652 ACTGCTTTGACTGTGGG         GTTATCATTGGGAGCATCTTCGAG
        |||||||||||||||||>>>...>>>||||||||||||||||||||||||
 193540 ACTGCTTTGACTGTGGGGTA...TAGGTTATCATTGGGAGCATCTTCGAG

   1800     .    :    .    :    .    :    .    :    .    :
   1693 GTCATCTGGGCTGTCATAAAACCTGGCACATCCTTTGGAATCAGCGTGTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 197721 GTCATCTGGGCTGTCATAAAACCTGGCACATCCTTTGGAATCAGCGTGTT

   1850     .    :    .    :    .    :    .    :    .    :
   1743 ACGAGCCCTCAGGTTATTGCGTATTTTCAAAGTCACAAA         GT
        |||||||||||||||||||||||||||||||||||||||>>>...>>>||
 197771 ACGAGCCCTCAGGTTATTGCGTATTTTCAAAGTCACAAAGTA...CAGGT

   1900     .    :    .    :    .    :    .    :    .    :
   1784 ACTGGGCATCTCTCAGAAACCTGGTCGTCTCTCTCCTCAACTCCATGAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 197976 ACTGGGCATCTCTCAGAAACCTGGTCGTCTCTCTCCTCAACTCCATGAAG

   1950     .    :    .    :    .    :    .    :    .    :
   1834 TCCATCATCAGCCTGTTGTTTCTCCTTTTCCTGTTCATTGTCGTCTTCGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 198026 TCCATCATCAGCCTGTTGTTTCTCCTTTTCCTGTTCATTGTCGTCTTCGC

   2000     .    :    .    :    .    :    .    :    .    :
   1884 CCTTTTGGGAATGCAACTCTTCGGCGGCCA         GTTTAATTTCG
        ||||||||||||||||||||||||||||||>>>...>>>|||||||||||
 198076 CCTTTTGGGAATGCAACTCTTCGGCGGCCAGTA...CAGGTTTAATTTCG

   2050     .    :    .    :    .    :    .    :    .    :
   1925 ATGAAGGGACTCCTCCCACCAACTTCGATACTTTTCCAGCAGCAATAATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 198382 ATGAAGGGACTCCTCCCACCAACTTCGATACTTTTCCAGCAGCAATAATG

   2100     .    :    .    :    .    :    .    :    .    :
   1975 ACGGTGTTTCAG         ATCCTGACGGGCGAAGACTGGAACGAGGT
        ||||||||||||>>>...>>>|||||||||||||||||||||||||||||
 198432 ACGGTGTTTCAGGTA...CAGATCCTGACGGGCGAAGACTGGAACGAGGT

   2150     .    :    .    :    .    :    .    :    .    :
   2016 CATGTACGACGGGATCAAGTCTCAGGGGGGCGTGCAGGGCGGCATGGTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 202370 CATGTACGACGGGATCAAGTCTCAGGGGGGCGTGCAGGGCGGCATGGTGT

   2200     .    :    .    :    .    :    .    :    .    :
   2066 TCTCCATCTATTTCATTGTACTGACACTCTTTGGGAACT         AC
        ||||||||||||||||||||||||| |||||||||||||>>>...>>>||
 202420 TCTCCATCTATTTCATTGTACTGACGCTCTTTGGGAACTGTA...CAGAC

   2250     .    :    .    :    .    :    .    :    .    :
   2107 ACCCTCCTGAATGTGTTCTTGGCCATCGCTGTGGACAATCTGGCCAACGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 202614 ACCCTCCTGAATGTGTTCTTGGCCATCGCTGTGGACAATCTGGCCAACGC

   2300     .    :    .    :    .    :    .    :    .    :
   2157 CCAGGAGCTCACCAAG         GACGAGCAAGAGGAAGAAGAAGCAG
        ||||||||||||||||>>>...>>>|||||||||||||||||||||||||
 202664 CCAGGAGCTCACCAAGGTG...TAGGACGAGCAAGAGGAAGAAGAAGCAG

   2350     .    :    .    :    .    :    .    :    .    :
   2198 CGAACCAGAAACTTGCCCTACAGAAAGCCAAGGAGGTGGCAGAAGTGAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 205594 CGAACCAGAAACTTGCCCTACAGAAAGCCAAGGAGGTGGCAGAAGTGAGT

   2400     .    :    .    :    .    :    .    :    .    :
   2248 CCTCTGTCCGCGGCCAACATGTCTATAGCTGT         GAAAGAGCA
        ||||||||||||||||||||||||||||||||>>>...>>>|||||||||
 205644 CCTCTGTCCGCGGCCAACATGTCTATAGCTGTGTA...CAGGAAAGAGCA

   2450     .    :    .    :    .    :    .    :    .    :
   2289 ACAGAAGAATCAAAAGCCAGCCAAGTCCGTGTGGGAGCAGCGGACCAGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 206881 ACAGAAGAATCAAAAGCCAGCCAAGTCCGTGTGGGAGCAGCGGACCAGTG

   2500     .    :    .    :    .    :    .    :    .    :
   2339 AGATGCGAAAGCAGAACTTGCTGGCCAGCCGGGAGGCCCTGTATAACGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 206931 AGATGCGAAAGCAGAACTTGCTGGCCAGCCGGGAGGCCCTGTATAACGAA

   2550     .    :    .    :    .    :    .    :    .    :
   2389 ATGGACCCGGACGAGCGCTGGAAGGCTGCCTACACGCGGCACCTGCGGCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 206981 ATGGACCCGGACGAGCGCTGGAAGGCTGCCTACACGCGGCACCTGCGGCC

   2600     .    :    .    :    .    :    .    :    .    :
   2439 AGACATGAAGACGCACTTGGACCGGCCGCTGGTGGTGGACCCGCAGGAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207031 AGACATGAAGACGCACTTGGACCGGCCGCTGGTGGTGGACCCGCAGGAGA

   2650     .    :    .    :    .    :    .    :    .    :
   2489 ACCGCAACAACAACACCAACAAGAGCCGGGCGGCCGAGCCCACCGTGGAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207081 ACCGCAACAACAACACCAACAAGAGCCGGGCGGCCGAGCCCACCGTGGAC

   2700     .    :    .    :    .    :    .    :    .    :
   2539 CAGCGCCTCGGCCAGCAGCGCGCCGAGGACTTCCTCAGGAAACAGGCCCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207131 CAGCGCCTCGGCCAGCAGCGCGCCGAGGACTTCCTCAGGAAACAGGCCCG

   2750     .    :    .    :    .    :    .    :    .    :
   2589 CTACCACGATCGGGCCCGGGACCCCAGCGGCTCGGCGGGCCTGGACGCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207181 CTACCACGATCGGGCCCGGGACCCCAGCGGCTCGGCGGGCCTGGACGCAC

   2800     .    :    .    :    .    :    .    :    .    :
   2639 GGAGGCCCTGGGCGGGAAGCCAGGAGGCCGAGCTGAGCCGGGAGG ACCC
        |||||||||||||||||||||||||||||||||||||||||||||-||||
 207231 GGAGGCCCTGGGCGGGAAGCCAGGAGGCCGAGCTGAGCCGGGAGGGACCC

   2850     .    :    .    :    .    :    .    :    .    :
   2688 CTACGGCCGCGAGTCGGACCACCACGCCCGGGAGGGCAGCCTGGAGCAAC
        -|||||||||||||||||||||||||||||||||||||||||||||||||
 207281  TACGGCCGCGAGTCGGACCACCACGCCCGGGAGGGCAGCCTGGAGCAAC

   2900     .    :    .    :    .    :    .    :    .    :
   2738 CCGGGTTCTGGGAGGGCGAGGCCGAGCGAGGCAAGGCCGGGGACCCCCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207330 CCGGGTTCTGGGAGGGCGAGGCCGAGCGAGGCAAGGCCGGGGACCCCCAC

   2950     .    :    .    :    .    :    .    :    .    :
   2788 CGGAGGCACGTGCACCGGCAGGGGGGCAGCAGGGAGAGCCGCAGCGGGTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207380 CGGAGGCACGTGCACCGGCAGGGGGGCAGCAGGGAGAGCCGCAGCGGGTC

   3000     .    :    .    :    .    :    .    :    .    :
   2838 CCCGCGCACGGGCGCGAACGGGGAGCATCGACGTCATCGCGCGCACCGCA
        |||||||||||||||| |||||||||||||||||||||||||||||||||
 207430 CCCGCGCACGGGCGCGGACGGGGAGCATCGACGTCATCGCGCGCACCGCA

   3050     .    :    .    :    .    :    .    :    .    :
   2888 GCCCCGGGGAGGAGGGTCCGGAGGACAAGGCGGAGCGGAGGGCGCGGCAC
        | ||||||||||||||||||||||||||||||||||||||||||||||||
 207480 GGCCCGGGGAGGAGGGTCCGGAGGACAAGGCGGAGCGGAGGGCGCGGCAC

   3100     .    :    .    :    .    :    .    :    .    :
   2938 CGCGAGGGCAGCCGGCCGGCCCGGGGCGGCGAGGGCGAGGGCGAGGGCCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207530 CGCGAGGGCAGCCGGCCGGCCCGGGGCGGCGAGGGCGAGGGCGAGGGCCC

   3150     .    :    .    :    .    :    .    :    .    :
   2988 CGACGGGGGCGAGCGCAGGAGAAGGCACCGGCATGGCGCTCCAGCCACGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207580 CGACGGGGGCGAGCGCAGGAGAAGGCACCGGCATGGCGCTCCAGCCACGT

   3200     .    :    .    :    .    :    .    :    .    :
   3038 ACGAGGGGGACGCGCGGAGGGAGGACAAGGAGCGGAGGCATCGGAGGAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207630 ACGAGGGGGACGCGCGGAGGGAGGACAAGGAGCGGAGGCATCGGAGGAGG

   3250     .    :    .    :    .    :    .    :    .    :
   3088 AA         AGAGAACCAGGGCTCCGGGGTCCCTGTGTCGGGCCCCAA
        ||>>>...>>>|||||||||||||||||||||||||||||||||||||||
 207680 AAGTA...CAGAGAGAACCAGGGCTCCGGGGTCCCTGTGTCGGGCCCCAA

   3300     .    :    .    :    .    :    .    :    .    :
   3129 CCTGTCAACCACCCGGCCAATCCAGCAGGACCTGGGCCGCCAAGACCCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219298 CCTGTCAACCACCCGGCCAATCCAGCAGGACCTGGGCCGCCAAGACCCAC

   3350     .    :    .    :    .    :    .    :    .    :
   3179 CCCTGGCAGAGGATATTGACAACATGAAGAACAACAAGCTGGCCACCGCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219348 CCCTGGCAGAGGATATTGACAACATGAAGAACAACAAGCTGGCCACCGCG

   3400     .    :    .    :    .    :    .    :    .    :
   3229 GAGTCGGCCGCTCCCCACGGCAGCCTTGGCCACGCCGGCCTGCCCCAGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219398 GAGTCGGCCGCTCCCCACGGCAGCCTTGGCCACGCCGGCCTGCCCCAGAG

   3450     .    :    .    :    .    :    .    :    .    :
   3279 CCCAGCCAAGATGGGAAACAGCACCGACCCCAGCCCCATGCTGGCCATCC
        ||||||||||||||||||||||||||||||| ||||||||||||||||||
 219448 CCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCATGCTGGCCATCC

   3500     .    :    .    :    .    :    .    :    .    :
   3329 CTGCCATGGCCACCAACCCCCAGAACGCCGCCAGCCGCCGGACGCCCAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219498 CTGCCATGGCCACCAACCCCCAGAACGCCGCCAGCCGCCGGACGCCCAAC

   3550     .    :    .    :    .    :    .    :    .    :
   3379 AACCCGGGGAACCCATCCAATCCCGGCCCCCCCAAGACCCCCGAGAATAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219548 AACCCGGGGAACCCATCCAATCCCGGCCCCCCCAAGACCCCCGAGAATAG

   3600     .    :    .    :    .    :    .    :    .    :
   3429 CCTTATCGTCACCAACCCCAGCGGCACCCAGACCAATTCAGCTAAGACTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219598 CCTTATCGTCACCAACCCCAGCGGCACCCAGACCAATTCAGCTAAGACTG

   3650     .    :    .    :    .    :    .    :    .    :
   3479 CCAGGAAACCCGACCACACCACAGTGGACATCCCCCCAGCCTGCCCACCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219648 CCAGGAAACCCGACCACACCACAGTGGACATCCCCCCAGCCTGCCCACCC

   3700     .    :    .    :    .    :    .    :    .    :
   3529 CCCCTCAACCACACCGTCGTACAAG         TGAACAAAAACGCCAA
        |||||||||||||||||||||||||>>>...>>>||||||||||||||||
 219698 CCCCTCAACCACACCGTCGTACAAGGTG...CAGTGAACAAAAACGCCAA

   3750     .    :    .    :    .    :    .    :    .    :
   3570 CCCAGACCCACTGCCAAAAAAAGAGGAAGAGAAGAAGGAGGAGGAGGAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 221035 CCCAGACCCACTGCCAAAAAAAGAGGAAGAGAAGAAGGAGGAGGAGGAAG

   3800     .    :    .    :    .    :    .    :    .    :
   3620 ACGACCGTGGGGAAGACGGCCCTAAGCCAATGCCTCCCTATAGCTCCATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 221085 ACGACCGTGGGGAAGACGGCCCTAAGCCAATGCCTCCCTATAGCTCCATG

   3850     .    :    .    :    .    :    .    :    .    :
   3670 TTCATCCTGTCCACGACCAACCC         CCTTCGCCGCCTGTGCCA
        |||||||||||||||||||||||>>>...>>>||||||||||||||||||
 221135 TTCATCCTGTCCACGACCAACCCGTG...CAGCCTTCGCCGCCTGTGCCA

   3900     .    :    .    :    .    :    .    :    .    :
   3711 TTACATCCTGAACCTGCGCTACTTTGAGATGTGCATCCTCATGGTCATTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 222847 TTACATCCTGAACCTGCGCTACTTTGAGATGTGCATCCTCATGGTCATTG

   3950     .    :    .    :    .    :    .    :    .    :
   3761 CCATGAGCAGCATCGCCCTGGCCGCCGAGGACCCTGTGCAGCCCAACGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 222897 CCATGAGCAGCATCGCCCTGGCCGCCGAGGACCCTGTGCAGCCCAACGCA

   4000     .    :    .    :    .    :    .    :    .    :
   3811 CCTCGGAACAAC         GTGCTGCGATACTTTGACTACGTTTTTAC
        ||||||||||||>>>...>>>|||||||||||||||||||||||||||||
 222947 CCTCGGAACAACGTG...CAGGTGCTGCGATACTTTGACTACGTTTTTAC

   4050     .    :    .    :    .    :    .    :    .    :
   3852 AGGCGTCTTTACCTTTGAGATGGTGATCAAG         ATGATTGACC
        |||||||||||||||||||||||||||||||>>>...>>>||||||||||
 229126 AGGCGTCTTTACCTTTGAGATGGTGATCAAGGTG...CAGATGATTGACC

   4100     .    :    .    :    .    :    .    :    .    :
   3893 TGGGGCTCGTCCTGCATCAGGGTGCCTACTTCCGTGACCTCTGGAATATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 230279 TGGGGCTCGTCCTGCATCAGGGTGCCTACTTCCGTGACCTCTGGAATATT

   4150     .    :    .    :    .    :    .    :    .    :
   3943 CTCGACTTCATAGTGGTCAGTGGGGCCCTGGTAGCCTTTGCCTTCAC   
        |||||||||||||||||||||||||||||||||||||||||||||||>>>
 230329 CTCGACTTCATAGTGGTCAGTGGGGCCCTGGTAGCCTTTGCCTTCACGTA

   4200     .    :    .    :    .    :    .    :    .    :
   3990       TGGCAATAGCAAAGGAAAAGACATCAACACGATTAAATCCCTCC
        ...>>>||||||||||||||||||||||||||||||||||||||||||||
 230379 ...CAGTGGCAATAGCAAAGGAAAAGACATCAACACGATTAAATCCCTCC

   4250     .    :    .    :    .    :    .    :    .    :
   4034 GAGTCCTCCGGGTGCTACGACCTCTTAAAACCATCAAGCGGCTGCCAAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 243436 GAGTCCTCCGGGTGCTACGACCTCTTAAAACCATCAAGCGGCTGCCAAAG

   4300     .    :    .    :    .    :    .    :    .    :
   4084 CTCAAG         GCTGTGTTTGACTGTGTGGTGAACTCACTTAAAAA
        ||||||>>>...>>>|||||||||||||||||||||||||||||||||||
 243486 CTCAAGGTG...CAGGCTGTGTTTGACTGTGTGGTGAACTCACTTAAAAA

   4350     .    :    .    :    .    :    .    :    .    :
   4125 CGTCTTCAACATCCTCATCGTCTACATGCTATTCATGTTCATCTTCGCCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 244650 CGTCTTCAACATCCTCATCGTCTACATGCTATTCATGTTCATCTTCGCCG

   4400     .    :    .    :    .    :    .    :    .    :
   4175 TGGTGGCTGTGCAGCTCTTCAAGGGGAAATTCTTCCACTGCACTGACGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 244700 TGGTGGCTGTGCAGCTCTTCAAGGGGAAATTCTTCCACTGCACTGACGAG

   4450     .    :    .    :    .    :    .    :    .    :
   4225 TCCAAAGAGTTTGAGAAAGATTGTCG         AGGCAAATACCTCCT
        ||||||||||||||||||||||||||>>>...>>>|||||||||||||||
 244750 TCCAAAGAGTTTGAGAAAGATTGTCGGTG...CAGAGGCAAATACCTCCT

   4500     .    :    .    :    .    :    .    :    .    :
   4266 CTACGAGAAGAATGAGGTGAAGGCGCGAGACCGGGAGTGGAAGAAGTATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 246539 CTACGAGAAGAATGAGGTGAAGGCGCGAGACCGGGAGTGGAAGAAGTATG

   4550     .    :    .    :    .    :    .    :    .    :
   4316 AATTCCATTACGACAATGTGCTGTGGGCTCTGCTGACCCTCTTCACCGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 246589 AATTCCATTACGACAATGTGCTGTGGGCTCTGCTGACCCTCTTCACCGTG

   4600     .    :    .    :    .    :    .    :    .    :
   4366 TCCACGGGAGAAGGCTGGCCACA         GGTCCTCAAGCATTCGGT
        |||||||||||||||||||||||>>>...>>>||||||||||||||||||
 246639 TCCACGGGAGAAGGCTGGCCACAGTA...CAGGGTCCTCAAGCATTCGGT

   4650     .    :    .    :    .    :    .    :    .    :
   4407 GGACGCCACCTTTGAGAACCAGGGCCCCAGCCCCGGGTACCGCATGGAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 248692 GGACGCCACCTTTGAGAACCAGGGCCCCAGCCCCGGGTACCGCATGGAGA

   4700     .    :    .    :    .    :    .    :    .    :
   4457 TGTCCATTTTCTACGTCGTCTACTTTGTGGTGTTCCCCTTCTTCTTTGTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 248742 TGTCCATTTTCTACGTCGTCTACTTTGTGGTGTTCCCCTTCTTCTTTGTC

   4750     .    :    .    :    .    :    .    :    .    :
   4507 AATATCTTTGTGGCCTTGATCATCATCACCTTCCAGGAGCAAGGGGACAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 248792 AATATCTTTGTGGCCTTGATCATCATCACCTTCCAGGAGCAAGGGGACAA

   4800     .    :    .    :    .    :    .    :    .    :
   4557 GATGATGGAGGAATACAGCCTGGAGAAAAATGAG         AGGGCCT
        ||||||||||||||||||||||||||||||||||>>>...>>>|||||||
 248842 GATGATGGAGGAATACAGCCTGGAGAAAAATGAGGTG...CAGAGGGCCT

   4850     .    :    .    :    .    :    .    :    .    :
   4598 GCATTGATTTCGCCATCAGCGCCAAGCCGCTGACCCGACACATGCCGCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 250973 GCATTGATTTCGCCATCAGCGCCAAGCCGCTGACCCGACACATGCCGCAG

   4900     .    :    .    :    .    :    .    :    .    :
   4648 AACAAGCAGAGCTTCCAGTACCGCATGTGGCAGTTCGTGGTGTCTCCGCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 251023 AACAAGCAGAGCTTCCAGTACCGCATGTGGCAGTTCGTGGTGTCTCCGCC

   4950     .    :    .    :    .    :    .    :    .    :
   4698 TTTCGAGTACACGATCATGGCCATGATCGCCCTCAACACCATCGTGCTTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 251073 TTTCGAGTACACGATCATGGCCATGATCGCCCTCAACACCATCGTGCTTA

   5000     .    :    .    :    .    :    .    :    .    :
   4748 TGATGAAG         TTCTATGGGGCTTCTGTTGCTTATGAAAATGCC
        ||||||||>>>...>>>|||||||||||||||||||||||||||||||||
 251123 TGATGAAGGTA...TAGTTCTATGGGGCTTCTGTTGCTTATGAAAATGCC

   5050     .    :    .    :    .    :    .    :    .    :
   4789 CTGCGGGTGTTCAACATCGTCTTCACCTCCCTCTTCTCTCTGGAATGTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 253157 CTGCGGGTGTTCAACATCGTCTTCACCTCCCTCTTCTCTCTGGAATGTGT

   5100     .    :    .    :    .    :    .    :    .    :
   4839 GCTGAAAGTCATGGCTTTTGGGATTCTG         AATTATTTCCGCG
        ||||||||||||||||||||||||||||>>>...>>>|||||||||||||
 253207 GCTGAAAGTCATGGCTTTTGGGATTCTGGTA...TAGAATTATTTCCGCG

   5150     .    :    .    :    .    :    .    :    .    :
   4880 ATGCCTGGAACATCTTCGACTTTGTGACTGTTCTGGGCAGCATCACCGAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 260973 ATGCCTGGAACATCTTCGACTTTGTGACTGTTCTGGGCAGCATCACCGAT

   5200     .    :    .    :    .    :    .    :    .    :
   4930 ATCCTCGTGACTGAGTTTGGG         AATAACTTCATCAACCTGAG
        |||||||||||||||||||||>>>...>>>||||||||||||||||||||
 261023 ATCCTCGTGACTGAGTTTGGGGTA...CAGAATAACTTCATCAACCTGAG

   5250     .    :    .    :    .    :    .    :    .    :
   4971 CTTTCTCCGCCTCTTCCGAGCTGCCCGGCTCATCAAACTTCTCCGTCAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 270515 CTTTCTCCGCCTCTTCCGAGCTGCCCGGCTCATCAAACTTCTCCGTCAGG

   5300     .    :    .    :    .    :    .    :    .    :
   5021 GTTACACCATCCGCATTCTTCTCTGGACCTTTGTGCAGTCCTTCAAG   
        |||||||||||||||||||||||||||||||||||||||||||||||>>>
 270565 GTTACACCATCCGCATTCTTCTCTGGACCTTTGTGCAGTCCTTCAAGGTG

   5350     .    :    .    :    .    :    .    :    .    :
   5068       GCCCTGCCTTATGTCTGTCTGCTGATCGCCATGCTCTTCTTCAT
        ...>>>||||||||||||||||||||||||||||||||||||||||||||
 270615 ...CAGGCCCTGCCTTATGTCTGTCTGCTGATCGCCATGCTCTTCTTCAT

   5400     .    :    .    :    .    :    .    :    .    :
   5112 CTATGCCATCATTGGGATGCAG         GTGTTTGGTAACATTGGCA
        ||||||||||||||||||||||>>>...>>>|||||||||||||||||||
 270995 CTATGCCATCATTGGGATGCAGGTG...CAGGTGTTTGGTAACATTGGCA

   5450     .    :    .    :    .    :    .    :    .    :
   5153 TCGACGTGGAGGACGAGGACAGTGATGAAGATGAGTTCCAAATCACTGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 271208 TCGACGTGGAGGACGAGGACAGTGATGAAGATGAGTTCCAAATCACTGAG

   5500     .    :    .    :    .    :    .    :    .    :
   5203 CACAATAACTTCCGGACCTTCTTCCAGGCCCTCATGCTTCTCTTCCG   
        |||||||||||||||||||||||||||||||||||||||||||||||>>>
 271258 CACAATAACTTCCGGACCTTCTTCCAGGCCCTCATGCTTCTCTTCCGGTG

   5550     .    :    .    :    .    :    .    :    .    :
   5250       GAGTGCCACCGGGGAAGCTTGGCACAACATCATGCTTTCCTGCC
        ...>>>||||||||||||||||||||||||||||||||||||||||||||
 271308 ...CAGGAGTGCCACCGGGGAAGCTTGGCACAACATCATGCTTTCCTGCC

   5600     .    :    .    :    .    :    .    :    .    :
   5294 TCAGCGGGAAACCGTGTGATAAGAACTCTGGCATCCTGACTCGAGAGTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 274409 TCAGCGGGAAACCGTGTGATAAGAACTCTGGCATCCTGACTCGAGAGTGT

   5650     .    :    .    :    .    :    .    :    .    :
   5344 GGCAATGAATTTGCTTATTTTTACTTTGTTTCCTTCATCTTCCTCTGCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 274459 GGCAATGAATTTGCTTATTTTTACTTTGTTTCCTTCATCTTCCTCTGCTC

   5700     .    :    .    :    .    :    .    :    .    :
   5394 GTTTCTG         ATGCTGAATCTCTTTGTCGCCGTCATCATGGACA
        |||||||>>>...>>>||||||||||||||||||||||||||||||||||
 274509 GTTTCTGGTG...CAGATGCTGAATCTCTTTGTCGCCGTCATCATGGACA

   5750     .    :    .    :    .    :    .    :    .    :
   5435 ACTTTGAGTACCTCACCCGAGACTCCTCCATCCTGGGCCCCCACCACCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 276050 ACTTTGAGTACCTCACCCGAGACTCCTCCATCCTGGGCCCCCACCACCTG

   5800     .    :    .    :    .    :    .    :    .    :
   5485 GATGAGTACGTGCGTGTCTGGGCCGAGTATGACCCCGCAGCTTG      
        ||||||||||||||||||||||||||||||||||||||||||||>>>...
 276100 GATGAGTACGTGCGTGTCTGGGCCGAGTATGACCCCGCAGCTTGGTA...

   5850     .    :    .    :    .    :    .    :    .    :
   5529    GGGCCGCATGCCTTACCTGGACATGTATCAGATGCTGAGACACATGT
        >>>|||||||||||||||||||||||||||||||||||||||||||||||
 278695 CAGGGGCCGCATGCCTTACCTGGACATGTATCAGATGCTGAGACACATGT

   5900     .    :    .    :    .    :    .    :    .    :
   5576 CTCCGCCCCTGGGTCTGGGGAAGAAGTGTCCGGCCAGAGTGGCTTACAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 278745 CTCCGCCCCTGGGTCTGGGGAAGAAGTGTCCGGCCAGAGTGGCTTACAAG

   5950     .    :    .    :    .    :    .    :    .    :
   5626          CGGCTTCTGCGGATGGACCTGCCCGTCGCAGATGACAACAC
        >>>...>>>|||||||||||||||||||||||||||||||||||||||||
 278795 GTA...TAGCGGCTTCTGCGGATGGACCTGCCCGTCGCAGATGACAACAC

   6000     .    :    .    :    .    :    .    :    .    :
   5667 CGTCCACTTCAATTCCACCCTCATGGCTCTGATCCGCACAGCCCTGGACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 281494 CGTCCACTTCAATTCCACCCTCATGGCTCTGATCCGCACAGCCCTGGACA

   6050     .    :    .    :    .    :    .    :    .    :
   5717 TCAAGATTGCCAAGG         GAGGAGCCGACAAACAGCAGATGGAC
        |||||||||||||||>>>...>>>||||||||||||||||||||||||||
 281544 TCAAGATTGCCAAGGGTA...CAGGAGGAGCCGACAAACAGCAGATGGAC

   6100     .    :    .    :    .    :    .    :    .    :
   5758 GCTGAGCTGCGGAAGGAGATGATGGCGATTTGGCCCAATCTGTCCCAGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 291643 GCTGAGCTGCGGAAGGAGATGATGGCGATTTGGCCCAATCTGTCCCAGAA

   6150     .    :    .    :    .    :    .    :    .    :
   5808 GACGCTAGACCTGCTGGTCACACCTCACAAGT         CCACGGACC
        ||||||||||||||||||||||||||||||||>>>...>>>|||||||||
 291693 GACGCTAGACCTGCTGGTCACACCTCACAAGTGTA...CAGCCACGGACC

   6200     .    :    .    :    .    :    .    :    .    :
   5849 TCACCGTGGGGAAGATCTACGCAGCCATGATGATCATGGAGTACTACCGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 291901 TCACCGTGGGGAAGATCTACGCAGCCATGATGATCATGGAGTACTACCGG

   6250     .    :    .    :    .    :    .    :    .    :
   5899 CAGAGCAAGGCCAAGAAGCTGCAGGCCATGCGCGAGGAGCAG        
        ||||||||||||||||||||||||||||||||||||||||||>>>...>>
 291951 CAGAGCAAGGCCAAGAAGCTGCAGGCCATGCGCGAGGAGCAGGTG...CA

   6300     .    :    .    :    .    :    .    :    .    :
   5941  GACCGGACACCCCTCATGTTCCAGCGCATGGAGCCCCCGTCCCCAACGC
        >|||||||||||||||||||||||||||||||||||||||||||||||||
 293484 GGACCGGACACCCCTCATGTTCCAGCGCATGGAGCCCCCGTCCCCAACGC

   6350     .    :    .    :    .    :    .    :    .    :
   5990 AGGAAGGGGGACCTGGCCAGAACGCCCTCCCCTCCACCCAGCTGGACCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 293534 AGGAAGGGGGACCTGGCCAGAACGCCCTCCCCTCCACCCAGCTGGACCCA

   6400     .    :    .    :    .    :    .    :    .    :
   6040 GGAGGAGCCCT         GATGGCTCACGAAAGCGGCCTCAAGGAGAG
        |||||||||||>>>...>>>||||||||||||||||||||||||||||||
 293584 GGAGGAGCCCTGTG...CAGGATGGCTCACGAAAGCGGCCTCAAGGAGAG

   6450     .    :    .    :    .    :    .    :    .    :
   6081 CCCGTCCTGGGTGACCCAGCGTGCCCAGGAGATGTTCCAGAAGACGGGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 293733 CCCGTCCTGGGTGACCCAGCGTGCCCAGGAGATGTTCCAGAAGACGGGCA

   6500     .    :    .    :    .    :    .    :    .    :
   6131 CATGGAGTCCGGAACAAGGCCCCCCTACCGACATGCCCAACAGCCAGCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 293783 CATGGAGTCCGGAACAAGGCCCCCCTACCGACATGCCCAACAGCCAGCCT

   6550     .    :    .    :    .    :    .    :    .    :
   6181 AACTCTCAG         TCCGTGGAGATGCGAGAGATGGGCAGAGATGG
        |||||||||>>>...>>>||||||||||||||||||||||||||||||||
 293833 AACTCTCAGGTG...CAGTCCGTGGAGATGCGAGAGATGGGCAGAGATGG

   6600     .    :    .    :    .    :    .    :    .    :
   6222 CTACTCCGACAGCGAGCACTACCTCCCCATGGAAGGCCAGGGCCGGGCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 294041 CTACTCCGACAGCGAGCACTACCTCCCCATGGAAGGCCAGGGCCGGGCTG

   6650     .    :    .    :    .    :    .    :    .    :
   6272 CCTCCATGCCCCGCCTCCCTGCAGAGAACCAG         AGGAGAAGG
        ||||||||||||||||||||||||||||||||>>>...>>>|||||||||
 294091 CCTCCATGCCCCGCCTCCCTGCAGAGAACCAGGTG...CAGAGGAGAAGG

   6700     .    :    .    :    .    :    .    :    .    :
   6313 GGCCGGCCACGTGGGAATAACCTCAGT         ACCATCTCAGACAC
        |||||||||||||||||||||||||||>>>...>>>||||||||||||||
 295582 GGCCGGCCACGTGGGAATAACCTCAGTGTA...CAGACCATCTCAGACAC

   6750     .    :    .    :    .    :    .    :    .    :
   6354 CAGCCCCATGAAGCGTTCAGCCTCCGTGCTGGGCCCCAAGGCCCGACGCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 296741 CAGCCCCATGAAGCGTTCAGCCTCCGTGCTGGGCCCCAAGGCCCGACGCC

   6800     .    :    .    :    .    :    .    :    .    :
   6404 TGGACGATTACTCGCTGGAGCGGGTCCCGCCCGAGGAGAACCAGCGGCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 296791 TGGACGATTACTCGCTGGAGCGGGTCCCGCCCGAGGAGAACCAGCGGCAC

   6850     .    :    .    :    .    :    .    :    .    :
   6454 CACCAGCGGCGCCGCGACCGCAGCCACCGCGCCTCTGAGCGCTCCCTGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 296841 CACCAGCGGCGCCGCGACCGCAGCCACCGCGCCTCTGAGCGCTCCCTGGG

   6900     .    :    .    :    .    :    .    :    .    :
   6504 CCGCTACACCGATGTGGACACAG         GCTTGGGGACAGACCTGA
        |||||||||||||||||||||||>>>...>>>||||||||||||||||||
 296891 CCGCTACACCGATGTGGACACAGGTG...CAGGCTTGGGGACAGACCTGA

   6950     .    :    .    :    .    :    .    :    .    :
   6545 GCATGACCACCCAATCCGGGGACCTGCCGTCGAAGGAGCGGGACCAGGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 297234 GCATGACCACCCAATCCGGGGACCTGCCGTCGAAGGAGCGGGACCAGGAG

   7000     .    :    .    :    .    :    .    :    .    :
   6595 CGGGGCCGGCCCAAGGATCGGAAGCATCGACAGCACCACCACCACCACCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 297284 CGGGGCCGGCCCAAGGATCGGAAGCATCGACAGCACCACCACCACCACCA

   7050     .    :    .    :    .    :    .    :    .    :
   6645 CCACCACCACCATCCCCCGCCCCCCGACAAGGACCGCTATGCCCAGGAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 297334 CCACCACCACCATCCCCCGCCCCCCGACAAGGACCGCTATGCCCAGGAAC

   7100     .    :    .    :    .    :    .    :    .    :
   6695 GGCCGGACCACGGCCGGGCACGGGCTCGGGACCAGCGCTGGTCCCGCTCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 297384 GGCCGGACCACGGCCGGGCACGGGCTCGGGACCAGCGCTGGTCCCGCTCG

   7150     .    :    .    :    .    :    .    :    .    :
   6745 CCCAGCGAGGGCCGAGAGCACATGGCGCACCGGCAG         GGCAG
        ||||||||||||||||||||||||||||||||||||>>>...>>>|||||
 297434 CCCAGCGAGGGCCGAGAGCACATGGCGCACCGGCAGGTG...TAGGGCAG

   7200     .    :    .    :    .    :    .    :    .    :
   6786 TAGTTCCGTAAGTGGAAGCCCAGCCCCCTCAACATCTGGTACCAGCACTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298177 TAGTTCCGTAAGTGGAAGCCCAGCCCCCTCAACATCTGGTACCAGCACTC

   7250     .    :    .    :    .    :    .    :    .    :
   6836 CGCGGCGGGGCCGCCGCCAGCTCCCCCAGACCCCCTCCACCCCCCGGCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298227 CGCGGCGGGGCCGCCGCCAGCTCCCCCAGACCCCCTCCACCCCCCGGCCA

   7300     .    :    .    :    .    :    .    :    .    :
   6886 CACGTGTCCTATTCCCCTGTGATCCGTAAGGCCGGCGGCTCGGGGCCCCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298277 CACGTGTCCTATTCCCCTGTGATCCGTAAGGCCGGCGGCTCGGGGCCCCC

   7350     .    :    .    :    .    :    .    :    .    :
   6936 GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGGCGGTGGCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298327 GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGGCGGTGGCCA

   7400     .    :    .    :    .    :    .    :    .    :
   6986 GGCCGGGCCGGGCGGCCACCAGCGGCCCTCGGAGGTACCCAGGCCCCACG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298377 GGCCGGGCCGGGCGGCCACCAGCGGCCCTCGGAGGTACCCAGGCCCCACG

   7450     .    :    .    :    .    :    .    :    .    :
   7036 GCCGAGCCTCTGGCCGGAGATCGGCCGCCCACGGGGGGCCACAGCAGCGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298427 GCCGAGCCTCTGGCCGGAGATCGGCCGCCCACGGGGGGCCACAGCAGCGG

   7500     .    :    .    :    .    :    .    :    .    :
   7086 CCGCTCGCCCAGGATGGAGAGGCGGGTCCCAGGCCCGGCCCGGAGCGAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298477 CCGCTCGCCCAGGATGGAGAGGCGGGTCCCAGGCCCGGCCCGGAGCGAGT

   7550     .    :    .    :    .    :    .    :    .    :
   7136 CCCCCAGGGCCTGTCGACACGGCGGGGCCCGGTGGCCGGCATCTGGCCCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298527 CCCCCAGGGCCTGTCGACACGGCGGGGCCCGGTGGCCGGCATCTGGCCCG

   7600     .    :    .    :    .    :    .    :    .    :
   7186 CACGTGTCCGAGGGGCCCCCGGGTCCCCGGCACCATGGCTACTACCGGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298577 CACGTGTCCGAGGGGCCCCCGGGTCCCCGGCACCATGGCTACTACCGGGG

   7650     .    :    .    :    .    :    .    :    .    :
   7236 CTCCGACTACGACGAGGCCGATGGCCCGGGCAGCGGGGGCGGCGAGGAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298627 CTCCGACTACGACGAGGCCGATGGCCCGGGCAGCGGGGGCGGCGAGGAGG

   7700     .    :    .    :    .    :    .    :    .    :
   7286 CCATGGCCGGGGCCTACGACGCGCCACCCCCCGTACGACACGCGTCCTCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298677 CCATGGCCGGGGCCTACGACGCGCCACCCCCCGTACGACACGCGTCCTCG

   7750     .    :    .    :    .    :    .    :    .    :
   7336 GGCGCCACCGGGCGCTCGCCCAGGACTCCCCGGGCCTCGGGCCCGGCCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298727 GGCGCCACCGGGCGCTCGCCCAGGACTCCCCGGGCCTCGGGCCCGGCCTG

   7800     .    :    .    :    .    :    .    :    .    :
   7386 CGCCTCGCCTTCTCGGCACGGCCGGCGACTCCCCAACGGCTACTACCCGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298777 CGCCTCGCCTTCTCGGCACGGCCGGCGACTCCCCAACGGCTACTACCCGG

   7850     .    :    .    :    .    :    .    :    .    :
   7436 CGCACGGACTGGCCAGGCCCCGCGGGCCGGGCTCCAGGAAGGGCCTGCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298827 CGCACGGACTGGCCAGGCCCCGCGGGCCGGGCTCCAGGAAGGGCCTGCAC

   7900     .    :    .    :    .    :    .
   7486 GAACCCTACAGCGAGAGTGACGATGATTGGTGCTAA
        ||||||||||||||||||||||||||||||||||||
 298877 GAACCCTACAGCGAGAGTGACGATGATTGGTGCTAA

END