Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AB035726.1
Subject Sequence ID: ENSG00000141837
Subject Sequence type: 2


seq1 = /RAID/mart2/Splice/web_temp/fasta/AB035726.1, 7450 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000141837 (ENSG00000141837), 298924 bp

>gi|7630180|dbj|AB035726.1| Homo sapiens CACNA1A mRNA for alpha1A-voltage-dependent calcium channel, partial cds, isolate:TMDN-SCA6-001
>ENSG00000141837

(complement)

36-328  (1-293)   100% ->
329-434  (51013-51118)   100% ->
435-574  (53210-53349)   100% ->
575-666  (134446-134537)   100% ->
667-819  (140756-140908)   100% ->
820-1013  (146426-146619)   100% ->
1014-1117  (170316-170419)   100% ->
1118-1233  (171732-171847)   99% ->
1234-1290  (173300-173356)   100% ->
1291-1383  (175889-175981)   100% ->
1384-1593  (188904-189113)   99% ->
1594-1706  (193444-193556)   100% ->
1707-1819  (197697-197809)   100% ->
1820-1951  (197974-198105)   100% ->
1952-2024  (198371-198443)   97% ->
2025-2142  (202341-202458)   99% ->
2143-2210  (202612-202679)   94% ->
2211-2317  (205569-205675)   100% ->
2318-3127  (206872-207681)   99% ->
3128-3591  (219259-219722)   100% ->
3592-3730  (221019-221157)   100% ->
3731-3860  (222829-222958)   100% ->
3861-3920  (229097-229156)   100% ->
3921-4027  (230269-230375)   100% ->
4028-4127  (243392-243491)   100% ->
4128-4288  (244615-244775)   100% ->
4289-4426  (246524-246661)   100% ->
4427-4628  (248674-248875)   100% ->
4629-4793  (250966-251130)   100% ->
4794-4904  (253124-253234)   100% ->
4905-4988  (260960-261043)   100% ->
4989-5105  (270495-270611)   100% ->
5106-5171  (270951-271016)   100% ->
5172-5287  (271189-271304)   100% ->
5288-5438  (274365-274515)   99% ->
5439-5566  (276016-276143)   100% ->
5567-5663  (277430-277526)   88% ->
5664-5769  (281453-281558)   100% ->
5770-5877  (291617-291724)   100% ->
5878-5978  (291892-291992)   100% ->
5979-6088  (293485-293594)   100% ->
6089-6227  (293703-293841)   100% ->
6228-6341  (294009-294122)   100% ->
6342-6377  (295573-295608)   100% ->
6378-6564  (296727-296913)   100% ->
6565-6818  (297216-297469)   100% ->
6819-7450  (298172-298770)   94%

      0     .    :    .    :    .    :    .    :    .    :
     36 ATGGCCCGCTTCGGAGACGAGATGCCGGCCCGCTACGGGGGAGGAGGCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      1 ATGGCCCGCTTCGGAGACGAGATGCCGGCCCGCTACGGGGGAGGAGGCTC

     50     .    :    .    :    .    :    .    :    .    :
     86 CGGGGCAGCCGCCGGGGTGGTCGTGGGCAGCGGAGGCGGGCGAGGAGCCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     51 CGGGGCAGCCGCCGGGGTGGTCGTGGGCAGCGGAGGCGGGCGAGGAGCCG

    100     .    :    .    :    .    :    .    :    .    :
    136 GGGGCAGCCGGCAGGGCGGGCAGCCCGGGGCGCAAAGGATGTACAAGCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    101 GGGGCAGCCGGCAGGGCGGGCAGCCCGGGGCGCAAAGGATGTACAAGCAG

    150     .    :    .    :    .    :    .    :    .    :
    186 TCAATGGCGCAGAGAGCGCGGACCATGGCACTCTACAACCCCATCCCCGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    151 TCAATGGCGCAGAGAGCGCGGACCATGGCACTCTACAACCCCATCCCCGT

    200     .    :    .    :    .    :    .    :    .    :
    236 CCGACAGAACTGCCTCACGGTTAACCGGTCTCTCTTCCTCTTCAGCGAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    201 CCGACAGAACTGCCTCACGGTTAACCGGTCTCTCTTCCTCTTCAGCGAAG

    250     .    :    .    :    .    :    .    :    .    :
    286 ACAACGTGGTGAGAAAATACGCCAAAAAGATCACCGAATGGCC       
        |||||||||||||||||||||||||||||||||||||||||||>>>...>
    251 ACAACGTGGTGAGAAAATACGCCAAAAAGATCACCGAATGGCCATA...T

    300     .    :    .    :    .    :    .    :    .    :
    329   TCCCTTTGAATATATGATTTTAGCCACCATCATAGCGAATTGCATCGT
        >>||||||||||||||||||||||||||||||||||||||||||||||||
  51011 ACTCCCTTTGAATATATGATTTTAGCCACCATCATAGCGAATTGCATCGT

    350     .    :    .    :    .    :    .    :    .    :
    377 CCTCGCACTGGAGCAGCATCTGCCTGATGATGACAAGACCCCGATGTCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  51061 CCTCGCACTGGAGCAGCATCTGCCTGATGATGACAAGACCCCGATGTCTG

    400     .    :    .    :    .    :    .    :    .    :
    427 AACGGCTG         GATGACACAGAACCATACTTCATTGGAATTTTT
        ||||||||>>>...>>>|||||||||||||||||||||||||||||||||
  51111 AACGGCTGGTG...CAGGATGACACAGAACCATACTTCATTGGAATTTTT

    450     .    :    .    :    .    :    .    :    .    :
    468 TGTTTCGAGGCTGGAATTAAAATCATTGCCCTTGGGTTTGCCTTCCACAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  53243 TGTTTCGAGGCTGGAATTAAAATCATTGCCCTTGGGTTTGCCTTCCACAA

    500     .    :    .    :    .    :    .    :    .    :
    518 AGGCTCCTACTTGAGGAATGGCTGGAATGTCATGGACTTTGTGGTGGTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  53293 AGGCTCCTACTTGAGGAATGGCTGGAATGTCATGGACTTTGTGGTGGTGC

    550     .    :    .    :    .    :    .    :    .    :
    568 TAACGGG         CATCTTGGCGACAGTTGGGACGGAGTTTGACCTA
        |||||||>>>...>>>||||||||||||||||||||||||||||||||||
  53343 TAACGGGGTA...CAGCATCTTGGCGACAGTTGGGACGGAGTTTGACCTA

    600     .    :    .    :    .    :    .    :    .    :
    609 CGGACGCTGAGGGCAGTTCGAGTGCTGCGGCCGCTCAAGCTGGTGTCTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 134480 CGGACGCTGAGGGCAGTTCGAGTGCTGCGGCCGCTCAAGCTGGTGTCTGG

    650     .    :    .    :    .    :    .    :    .    :
    659 AATCCCAA         GTTTACAAGTCGTCCTGAAGTCGATCATGAAGG
        ||||||||>>>...>>>|||||||||||||||||||||||||||||||||
 134530 AATCCCAAGTG...CAGGTTTACAAGTCGTCCTGAAGTCGATCATGAAGG

    700     .    :    .    :    .    :    .    :    .    :
    700 CGATGATCCCTTTGCTGCAGATCGGCCTCCTCCTATTTTTTGCAATCCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 140789 CGATGATCCCTTTGCTGCAGATCGGCCTCCTCCTATTTTTTGCAATCCTT

    750     .    :    .    :    .    :    .    :    .    :
    750 ATTTTTGCAATCATAGGGTTAGAATTTTATATGGGAAAATTTCATACCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 140839 ATTTTTGCAATCATAGGGTTAGAATTTTATATGGGAAAATTTCATACCAC

    800     .    :    .    :    .    :    .    :    .    :
    800 CTGCTTTGAAGAGGGGACAG         ATGACATTCAGGGTGAGTCTC
        ||||||||||||||||||||>>>...>>>|||||||||||||||||||||
 140889 CTGCTTTGAAGAGGGGACAGGTA...TAGATGACATTCAGGGTGAGTCTC

    850     .    :    .    :    .    :    .    :    .    :
    841 CGGCTCCATGTGGGACAGAAGAGCCCGCCCGCACCTGCCCCAATGGGACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 146447 CGGCTCCATGTGGGACAGAAGAGCCCGCCCGCACCTGCCCCAATGGGACC

    900     .    :    .    :    .    :    .    :    .    :
    891 AAATGTCAGCCCTACTGGGAAGGGCCCAACAACGGGATCACTCAGTTCGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 146497 AAATGTCAGCCCTACTGGGAAGGGCCCAACAACGGGATCACTCAGTTCGA

    950     .    :    .    :    .    :    .    :    .    :
    941 CAACATCCTGTTTGCAGTGCTGACTGTTTTCCAGTGCATAACCATGGAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 146547 CAACATCCTGTTTGCAGTGCTGACTGTTTTCCAGTGCATAACCATGGAAG

   1000     .    :    .    :    .    :    .    :    .    :
    991 GGTGGACTGATCTCCTCTACAAT         AGCAACGATGCCTCAGGG
        |||||||||||||||||||||||>>>...>>>||||||||||||||||||
 146597 GGTGGACTGATCTCCTCTACAATGTA...CAGAGCAACGATGCCTCAGGG

   1050     .    :    .    :    .    :    .    :    .    :
   1032 AACACTTGGAACTGGTTGTACTTCATCCCCCTCATCATCATCGGCTCCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 170334 AACACTTGGAACTGGTTGTACTTCATCCCCCTCATCATCATCGGCTCCTT

   1100     .    :    .    :    .    :    .    :    .    :
   1082 TTTTATGCTGAACCTTGTGCTGGGTGTGCTGTCAGG         GGAGT
        ||||||||||||||||||||||||||||||||||||>>>...>>>|||||
 170384 TTTTATGCTGAACCTTGTGCTGGGTGTGCTGTCAGGGTA...CAGGGAGT

   1150     .    :    .    :    .    :    .    :    .    :
   1123 TTGCCAAAGAAAGGGAACGGGTGGAGAACCGGCGGGCTTTTCTGAAGCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 171737 TTGCCAAAGAAAGGGAACGGGTGGAGAACCGGCGGGCTTTTCTGAAGCTG

   1200     .    :    .    :    .    :    .    :    .    :
   1173 AGGCGGCAACAACAGATTGAACGTGAGCTCAATGGGTACATGGAATGGAT
        |||||||||||||||||||||||||||||||||||||||||||| |||||
 171787 AGGCGGCAACAACAGATTGAACGTGAGCTCAATGGGTACATGGAGTGGAT

   1250     .    :    .    :    .    :    .    :    .    :
   1223 CTCAAAAGCAG         AAGAGGTGATCCTCGCCGAGGATGAAACTG
        |||||||||||>>>...>>>||||||||||||||||||||||||||||||
 171837 CTCAAAAGCAGGTG...CAGAAGAGGTGATCCTCGCCGAGGATGAAACTG

   1300     .    :    .    :    .    :    .    :    .    :
   1264 ACGGGGAGCAGAGGCATCCCTTTGATG         GAGCTCTGCGGAGA
        |||||||||||||||||||||||||||>>>...>>>||||||||||||||
 173330 ACGGGGAGCAGAGGCATCCCTTTGATGGTA...TTGGAGCTCTGCGGAGA

   1350     .    :    .    :    .    :    .    :    .    :
   1305 ACCACCATAAAGAAAAGCAAGACAGATTTGCTCAACCCCGAAGAGGCTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 175903 ACCACCATAAAGAAAAGCAAGACAGATTTGCTCAACCCCGAAGAGGCTGA

   1400     .    :    .    :    .    :    .    :    .    :
   1355 GGATCAGCTGGCTGATATAGCCTCTGTGG         GTTCTCCCTTCG
        |||||||||||||||||||||||||||||>>>...>>>||||||||||||
 175953 GGATCAGCTGGCTGATATAGCCTCTGTGGGTG...CAGGTTCTCCCTTCG

   1450     .    :    .    :    .    :    .    :    .    :
   1396 CCCGAGCCAGCATTAAAAGTACCAAGCTGGAGAACTCGACCTTTTTTCAC
        |||||||||||||||||||| |||||||||||||||||||||||||||||
 188916 CCCGAGCCAGCATTAAAAGTGCCAAGCTGGAGAACTCGACCTTTTTTCAC

   1500     .    :    .    :    .    :    .    :    .    :
   1446 AAAAAGGAGAGGAGGATGCGTTTCTACATCCGCCGCATGGTCAAAACTCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188966 AAAAAGGAGAGGAGGATGCGTTTCTACATCCGCCGCATGGTCAAAACTCA

   1550     .    :    .    :    .    :    .    :    .    :
   1496 GGCCTTCTACTGGACTGTACTCAGTTTGGTAGCTCTCAACACGCTGTGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 189016 GGCCTTCTACTGGACTGTACTCAGTTTGGTAGCTCTCAACACGCTGTGTG

   1600     .    :    .    :    .    :    .    :    .    :
   1546 TTGCTATTGTTCACTACAACCAGCCCGAGTGGCTCTCCGACTTCCTTT  
        ||||||||||||||||||||||||||||||||||||||||||||||||>>
 189066 TTGCTATTGTTCACTACAACCAGCCCGAGTGGCTCTCCGACTTCCTTTGT

   1650     .    :    .    :    .    :    .    :    .    :
   1594        ACTATGCAGAATTCATTTTCTTAGGACTCTTTATGTCCGAAAT
        >...>>>|||||||||||||||||||||||||||||||||||||||||||
 189116 G...TAGACTATGCAGAATTCATTTTCTTAGGACTCTTTATGTCCGAAAT

   1700     .    :    .    :    .    :    .    :    .    :
   1637 GTTTATAAAAATGTACGGGCTTGGGACGCGGCCTTACTTCCACTCTTCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 193487 GTTTATAAAAATGTACGGGCTTGGGACGCGGCCTTACTTCCACTCTTCCT

   1750     .    :    .    :    .    :    .    :    .    :
   1687 TCAACTGCTTTGACTGTGGG         GTTATCATTGGGAGCATCTTC
        ||||||||||||||||||||>>>...>>>|||||||||||||||||||||
 193537 TCAACTGCTTTGACTGTGGGGTA...TAGGTTATCATTGGGAGCATCTTC

   1800     .    :    .    :    .    :    .    :    .    :
   1728 GAGGTCATCTGGGCTGTCATAAAACCTGGCACATCCTTTGGAATCAGCGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 197718 GAGGTCATCTGGGCTGTCATAAAACCTGGCACATCCTTTGGAATCAGCGT

   1850     .    :    .    :    .    :    .    :    .    :
   1778 GTTACGAGCCCTCAGGTTATTGCGTATTTTCAAAGTCACAAA        
        ||||||||||||||||||||||||||||||||||||||||||>>>...>>
 197768 GTTACGAGCCCTCAGGTTATTGCGTATTTTCAAAGTCACAAAGTA...CA

   1900     .    :    .    :    .    :    .    :    .    :
   1820  GTACTGGGCATCTCTCAGAAACCTGGTCGTCTCTCTCCTCAACTCCATG
        >|||||||||||||||||||||||||||||||||||||||||||||||||
 197973 GGTACTGGGCATCTCTCAGAAACCTGGTCGTCTCTCTCCTCAACTCCATG

   1950     .    :    .    :    .    :    .    :    .    :
   1869 AAGTCCATCATCAGCCTGTTGTTTCTCCTTTTCCTGTTCATTGTCGTCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 198023 AAGTCCATCATCAGCCTGTTGTTTCTCCTTTTCCTGTTCATTGTCGTCTT

   2000     .    :    .    :    .    :    .    :    .    :
   1919 CGCCCTTTTGGGAATGCAACTCTTCGGCGGCCA         GTTTAATT
        |||||||||||||||||||||||||||||||||>>>...>>>||||||||
 198073 CGCCCTTTTGGGAATGCAACTCTTCGGCGGCCAGTA...CAGGTTTAATT

   2050     .    :    .    :    .    :    .    :    .    :
   1960 TCGATGAAGGGACGCCTCCCACCAACTTCGATACTTTTCCAGCAGCAAGA
        ||||||||||||| |||||||||||||||||||||||||||||||||| |
 198379 TCGATGAAGGGACTCCTCCCACCAACTTCGATACTTTTCCAGCAGCAATA

   2100     .    :    .    :    .    :    .    :    .    :
   2010 ATGACGGTGTTTCAG         AGCCTGACGGGCGAAGACTGGAACGA
        |||||||||||||||>>>...>>>| ||||||||||||||||||||||||
 198429 ATGACGGTGTTTCAGGTA...CAGATCCTGACGGGCGAAGACTGGAACGA

   2150     .    :    .    :    .    :    .    :    .    :
   2051 GGTCATGTACGACGGGATCAAGTCTCAGGGGGGCGTGCAGGGCGGCATGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 202367 GGTCATGTACGACGGGATCAAGTCTCAGGGGGGCGTGCAGGGCGGCATGG

   2200     .    :    .    :    .    :    .    :    .    :
   2101 TGTTCTCCATCTATTTCATTGTACTGACGCTCTTTGGGAACT        
        ||||||||||||||||||||||||||||||||||||||||||>>>...>>
 202417 TGTTCTCCATCTATTTCATTGTACTGACGCTCTTTGGGAACTGTA...CA

   2250     .    :    .    :    .    :    .    :    .    :
   2143  ACACCCTCCTGAATGTGTTCTTGGCCATCGCTGTGGACAATCTGGCCAA
        >|||||||||||||||||||||||||||||||||||||||||||||||||
 202611 GACACCCTCCTGAATGTGTTCTTGGCCATCGCTGTGGACAATCTGGCCAA

   2300     .    :    .    :    .    :    .    :    .    :
   2192 CGTTTTGGAGCTCACCAAG         GACGAGCAAGAGGAAGAAGAAG
        ||    |||||||||||||>>>...>>>||||||||||||||||||||||
 202661 CGCCCAGGAGCTCACCAAGGTG...TAGGACGAGCAAGAGGAAGAAGAAG

   2350     .    :    .    :    .    :    .    :    .    :
   2233 CAGCGAACCAGAAACTTGCCCTACAGAAAGCCAAGGAGGTGGCAGAAGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 205591 CAGCGAACCAGAAACTTGCCCTACAGAAAGCCAAGGAGGTGGCAGAAGTG

   2400     .    :    .    :    .    :    .    :    .    :
   2283 AGTCCTCTGTCCGCGGCCAACATGTCTATAGCTGT         GAAAGA
        |||||||||||||||||||||||||||||||||||>>>...>>>||||||
 205641 AGTCCTCTGTCCGCGGCCAACATGTCTATAGCTGTGTA...CAGGAAAGA

   2450     .    :    .    :    .    :    .    :    .    :
   2324 GCAACAGAAGAATCAAAAGCCAGCCAAGTCCGTGTGGGAGCAGCGGACCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 206878 GCAACAGAAGAATCAAAAGCCAGCCAAGTCCGTGTGGGAGCAGCGGACCA

   2500     .    :    .    :    .    :    .    :    .    :
   2374 GTGAGATGCGAAAGCAGAACTTGCTGGCCAGCCGGGAGGCCCTGTATAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 206928 GTGAGATGCGAAAGCAGAACTTGCTGGCCAGCCGGGAGGCCCTGTATAAC

   2550     .    :    .    :    .    :    .    :    .    :
   2424 GAAATGGACCCGGACGAGCGCTGGAAGGCTGCCTACACGCGGCACCTGCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 206978 GAAATGGACCCGGACGAGCGCTGGAAGGCTGCCTACACGCGGCACCTGCG

   2600     .    :    .    :    .    :    .    :    .    :
   2474 GCCAGACATGAAGACGCACTTGGACCGGCCGCTGGTGGTGGACCCGCAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207028 GCCAGACATGAAGACGCACTTGGACCGGCCGCTGGTGGTGGACCCGCAGG

   2650     .    :    .    :    .    :    .    :    .    :
   2524 AGAACCGCAACAACAACACCAACAAGAGCCGGGCGGCCGAGCCCACCGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207078 AGAACCGCAACAACAACACCAACAAGAGCCGGGCGGCCGAGCCCACCGTG

   2700     .    :    .    :    .    :    .    :    .    :
   2574 GACCAGCGCCTCGGCCAGCAGCGCGCCGAGGACTTCCTCAGGAAACAGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207128 GACCAGCGCCTCGGCCAGCAGCGCGCCGAGGACTTCCTCAGGAAACAGGC

   2750     .    :    .    :    .    :    .    :    .    :
   2624 CCGCTACCACGATCGGGCCCGGGACCCCAGCGGCTCGGCGGGCCTGGACG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207178 CCGCTACCACGATCGGGCCCGGGACCCCAGCGGCTCGGCGGGCCTGGACG

   2800     .    :    .    :    .    :    .    :    .    :
   2674 CACGGAGGCCCTGGGCGGGAAGCCAGGAGGCCGAGCTGAGCCGGGAGG A
        ||||||||||||||||||||||||||||||||||||||||||||||||-|
 207228 CACGGAGGCCCTGGGCGGGAAGCCAGGAGGCCGAGCTGAGCCGGGAGGGA

   2850     .    :    .    :    .    :    .    :    .    :
   2723 CCCCTACGGCCGCGAGTCGGACCACCACGCCCGGGAGGGCAGCCTGGAGC
        |||-||||||||||||||||||||||||||||||||||||||||||||||
 207278 CCC TACGGCCGCGAGTCGGACCACCACGCCCGGGAGGGCAGCCTGGAGC

   2900     .    :    .    :    .    :    .    :    .    :
   2773 AACCCGGGTTCTGGGACGGCGAGGCCGAGCGAGGCAAGGCCGGGGACCCC
        |||||||||||||||| |||||||||||||||||||||||||||||||||
 207327 AACCCGGGTTCTGGGAGGGCGAGGCCGAGCGAGGCAAGGCCGGGGACCCC

   2950     .    :    .    :    .    :    .    :    .    :
   2823 CACCGGAGGCACGTGCACCGGCAGGGGGGCAGCAGGGAGAGCCGCAGCGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207377 CACCGGAGGCACGTGCACCGGCAGGGGGGCAGCAGGGAGAGCCGCAGCGG

   3000     .    :    .    :    .    :    .    :    .    :
   2873 GTCCCCGCGCACGGGCGCGGACGGGGAGCATCGACGTCATCGCGCGCACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207427 GTCCCCGCGCACGGGCGCGGACGGGGAGCATCGACGTCATCGCGCGCACC

   3050     .    :    .    :    .    :    .    :    .    :
   2923 GCAGGCCCGGGGAGGAGGGTCCGGAGGACAAGGCGGAGCGGAGGGCGCGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207477 GCAGGCCCGGGGAGGAGGGTCCGGAGGACAAGGCGGAGCGGAGGGCGCGG

   3100     .    :    .    :    .    :    .    :    .    :
   2973 CACCGCGAGGGCAGCCGGCCGGCCCGGGGCGGCGAGGGCGAGGGCGAGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207527 CACCGCGAGGGCAGCCGGCCGGCCCGGGGCGGCGAGGGCGAGGGCGAGGG

   3150     .    :    .    :    .    :    .    :    .    :
   3023 CCCCGACGGGGGCGAGCGCAGGAGAAGGCACCGGCATGGCGCTCCAGCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207577 CCCCGACGGGGGCGAGCGCAGGAGAAGGCACCGGCATGGCGCTCCAGCCA

   3200     .    :    .    :    .    :    .    :    .    :
   3073 CGTACGAGGGGGACGCGCGGAGGGAGGACAAGGAGCGGAGGCATCGGAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 207627 CGTACGAGGGGGACGCGCGGAGGGAGGACAAGGAGCGGAGGCATCGGAGG

   3250     .    :    .    :    .    :    .    :    .    :
   3123 AGGAA         AGAGAACCAGGGCTCCGGGGTCCCTGTGTCGGGCCC
        |||||>>>...>>>||||||||||||||||||||||||||||||||||||
 207677 AGGAAGTA...CAGAGAGAACCAGGGCTCCGGGGTCCCTGTGTCGGGCCC

   3300     .    :    .    :    .    :    .    :    .    :
   3164 CAACCTGTCAACCACCCGGCCAATCCAGCAGGACCTGGGCCGCCAAGACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219295 CAACCTGTCAACCACCCGGCCAATCCAGCAGGACCTGGGCCGCCAAGACC

   3350     .    :    .    :    .    :    .    :    .    :
   3214 CACCCCTGGCAGAGGATATTGACAACATGAAGAACAACAAGCTGGCCACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219345 CACCCCTGGCAGAGGATATTGACAACATGAAGAACAACAAGCTGGCCACC

   3400     .    :    .    :    .    :    .    :    .    :
   3264 GCGGAGTCGGCCGCTCCCCACGGCAGCCTTGGCCACGCCGGCCTGCCCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219395 GCGGAGTCGGCCGCTCCCCACGGCAGCCTTGGCCACGCCGGCCTGCCCCA

   3450     .    :    .    :    .    :    .    :    .    :
   3314 GAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCATGCTGGCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219445 GAGCCCAGCCAAGATGGGAAACAGCACCGACCCCGGCCCCATGCTGGCCA

   3500     .    :    .    :    .    :    .    :    .    :
   3364 TCCCTGCCATGGCCACCAACCCCCAGAACGCCGCCAGCCGCCGGACGCCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219495 TCCCTGCCATGGCCACCAACCCCCAGAACGCCGCCAGCCGCCGGACGCCC

   3550     .    :    .    :    .    :    .    :    .    :
   3414 AACAACCCGGGGAACCCATCCAATCCCGGCCCCCCCAAGACCCCCGAGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219545 AACAACCCGGGGAACCCATCCAATCCCGGCCCCCCCAAGACCCCCGAGAA

   3600     .    :    .    :    .    :    .    :    .    :
   3464 TAGCCTTATCGTCACCAACCCCAGCGGCACCCAGACCAATTCAGCTAAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219595 TAGCCTTATCGTCACCAACCCCAGCGGCACCCAGACCAATTCAGCTAAGA

   3650     .    :    .    :    .    :    .    :    .    :
   3514 CTGCCAGGAAACCCGACCACACCACAGTGGACATCCCCCCAGCCTGCCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 219645 CTGCCAGGAAACCCGACCACACCACAGTGGACATCCCCCCAGCCTGCCCA

   3700     .    :    .    :    .    :    .    :    .    :
   3564 CCCCCCCTCAACCACACCGTCGTACAAG         TGAACAAAAACGC
        ||||||||||||||||||||||||||||>>>...>>>|||||||||||||
 219695 CCCCCCCTCAACCACACCGTCGTACAAGGTG...CAGTGAACAAAAACGC

   3750     .    :    .    :    .    :    .    :    .    :
   3605 CAACCCAGACCCACTGCCAAAAAAAGAGGAAGAGAAGAAGGAGGAGGAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 221032 CAACCCAGACCCACTGCCAAAAAAAGAGGAAGAGAAGAAGGAGGAGGAGG

   3800     .    :    .    :    .    :    .    :    .    :
   3655 AAGACGACCGTGGGGAAGACGGCCCTAAGCCAATGCCTCCCTATAGCTCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 221082 AAGACGACCGTGGGGAAGACGGCCCTAAGCCAATGCCTCCCTATAGCTCC

   3850     .    :    .    :    .    :    .    :    .    :
   3705 ATGTTCATCCTGTCCACGACCAACCC         CCTTCGCCGCCTGTG
        ||||||||||||||||||||||||||>>>...>>>|||||||||||||||
 221132 ATGTTCATCCTGTCCACGACCAACCCGTG...CAGCCTTCGCCGCCTGTG

   3900     .    :    .    :    .    :    .    :    .    :
   3746 CCATTACATCCTGAACCTGCGCTACTTTGAGATGTGCATCCTCATGGTCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 222844 CCATTACATCCTGAACCTGCGCTACTTTGAGATGTGCATCCTCATGGTCA

   3950     .    :    .    :    .    :    .    :    .    :
   3796 TTGCCATGAGCAGCATCGCCCTGGCCGCCGAGGACCCTGTGCAGCCCAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 222894 TTGCCATGAGCAGCATCGCCCTGGCCGCCGAGGACCCTGTGCAGCCCAAC

   4000     .    :    .    :    .    :    .    :    .    :
   3846 GCACCTCGGAACAAC         GTGCTGCGATACTTTGACTACGTTTT
        |||||||||||||||>>>...>>>||||||||||||||||||||||||||
 222944 GCACCTCGGAACAACGTG...CAGGTGCTGCGATACTTTGACTACGTTTT

   4050     .    :    .    :    .    :    .    :    .    :
   3887 TACAGGCGTCTTTACCTTTGAGATGGTGATCAAG         ATGATTG
        ||||||||||||||||||||||||||||||||||>>>...>>>|||||||
 229123 TACAGGCGTCTTTACCTTTGAGATGGTGATCAAGGTG...CAGATGATTG

   4100     .    :    .    :    .    :    .    :    .    :
   3928 ACCTGGGGCTCGTCCTGCATCAGGGTGCCTACTTCCGTGACCTCTGGAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 230276 ACCTGGGGCTCGTCCTGCATCAGGGTGCCTACTTCCGTGACCTCTGGAAT

   4150     .    :    .    :    .    :    .    :    .    :
   3978 ATTCTCGACTTCATAGTGGTCAGTGGGGCCCTGGTAGCCTTTGCCTTCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 230326 ATTCTCGACTTCATAGTGGTCAGTGGGGCCCTGGTAGCCTTTGCCTTCAC

   4200     .    :    .    :    .    :    .    :    .    :
   4028          TGGCAATAGCAAAGGAAAAGACATCAACACGATTAAATCCC
        >>>...>>>|||||||||||||||||||||||||||||||||||||||||
 230376 GTA...CAGTGGCAATAGCAAAGGAAAAGACATCAACACGATTAAATCCC

   4250     .    :    .    :    .    :    .    :    .    :
   4069 TCCGAGTCCTCCGGGTGCTACGACCTCTTAAAACCATCAAGCGGCTGCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 243433 TCCGAGTCCTCCGGGTGCTACGACCTCTTAAAACCATCAAGCGGCTGCCA

   4300     .    :    .    :    .    :    .    :    .    :
   4119 AAGCTCAAG         GCTGTGTTTGACTGTGTGGTGAACTCACTTAA
        |||||||||>>>...>>>||||||||||||||||||||||||||||||||
 243483 AAGCTCAAGGTG...CAGGCTGTGTTTGACTGTGTGGTGAACTCACTTAA

   4350     .    :    .    :    .    :    .    :    .    :
   4160 AAACGTCTTCAACATCCTCATCGTCTACATGCTATTCATGTTCATCTTCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 244647 AAACGTCTTCAACATCCTCATCGTCTACATGCTATTCATGTTCATCTTCG

   4400     .    :    .    :    .    :    .    :    .    :
   4210 CCGTGGTGGCTGTGCAGCTCTTCAAGGGGAAATTCTTCCACTGCACTGAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 244697 CCGTGGTGGCTGTGCAGCTCTTCAAGGGGAAATTCTTCCACTGCACTGAC

   4450     .    :    .    :    .    :    .    :    .    :
   4260 GAGTCCAAAGAGTTTGAGAAAGATTGTCG         AGGCAAATACCT
        |||||||||||||||||||||||||||||>>>...>>>||||||||||||
 244747 GAGTCCAAAGAGTTTGAGAAAGATTGTCGGTG...CAGAGGCAAATACCT

   4500     .    :    .    :    .    :    .    :    .    :
   4301 CCTCTACGAGAAGAATGAGGTGAAGGCGCGAGACCGGGAGTGGAAGAAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 246536 CCTCTACGAGAAGAATGAGGTGAAGGCGCGAGACCGGGAGTGGAAGAAGT

   4550     .    :    .    :    .    :    .    :    .    :
   4351 ATGAATTCCATTACGACAATGTGCTGTGGGCTCTGCTGACCCTCTTCACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 246586 ATGAATTCCATTACGACAATGTGCTGTGGGCTCTGCTGACCCTCTTCACC

   4600     .    :    .    :    .    :    .    :    .    :
   4401 GTGTCCACGGGAGAAGGCTGGCCACA         GGTCCTCAAGCATTC
        ||||||||||||||||||||||||||>>>...>>>|||||||||||||||
 246636 GTGTCCACGGGAGAAGGCTGGCCACAGTA...CAGGGTCCTCAAGCATTC

   4650     .    :    .    :    .    :    .    :    .    :
   4442 GGTGGACGCCACCTTTGAGAACCAGGGCCCCAGCCCCGGGTACCGCATGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 248689 GGTGGACGCCACCTTTGAGAACCAGGGCCCCAGCCCCGGGTACCGCATGG

   4700     .    :    .    :    .    :    .    :    .    :
   4492 AGATGTCCATTTTCTACGTCGTCTACTTTGTGGTGTTCCCCTTCTTCTTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 248739 AGATGTCCATTTTCTACGTCGTCTACTTTGTGGTGTTCCCCTTCTTCTTT

   4750     .    :    .    :    .    :    .    :    .    :
   4542 GTCAATATCTTTGTGGCCTTGATCATCATCACCTTCCAGGAGCAAGGGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 248789 GTCAATATCTTTGTGGCCTTGATCATCATCACCTTCCAGGAGCAAGGGGA

   4800     .    :    .    :    .    :    .    :    .    :
   4592 CAAGATGATGGAGGAATACAGCCTGGAGAAAAATGAG         AGGG
        |||||||||||||||||||||||||||||||||||||>>>...>>>||||
 248839 CAAGATGATGGAGGAATACAGCCTGGAGAAAAATGAGGTG...CAGAGGG

   4850     .    :    .    :    .    :    .    :    .    :
   4633 CCTGCATTGATTTCGCCATCAGCGCCAAGCCGCTGACCCGACACATGCCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 250970 CCTGCATTGATTTCGCCATCAGCGCCAAGCCGCTGACCCGACACATGCCG

   4900     .    :    .    :    .    :    .    :    .    :
   4683 CAGAACAAGCAGAGCTTCCAGTACCGCATGTGGCAGTTCGTGGTGTCTCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 251020 CAGAACAAGCAGAGCTTCCAGTACCGCATGTGGCAGTTCGTGGTGTCTCC

   4950     .    :    .    :    .    :    .    :    .    :
   4733 GCCTTTCGAGTACACGATCATGGCCATGATCGCCCTCAACACCATCGTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 251070 GCCTTTCGAGTACACGATCATGGCCATGATCGCCCTCAACACCATCGTGC

   5000     .    :    .    :    .    :    .    :    .    :
   4783 TTATGATGAAG         TTCTATGGGGCTTCTGTTGCTTATGAAAAT
        |||||||||||>>>...>>>||||||||||||||||||||||||||||||
 251120 TTATGATGAAGGTA...TAGTTCTATGGGGCTTCTGTTGCTTATGAAAAT

   5050     .    :    .    :    .    :    .    :    .    :
   4824 GCCCTGCGGGTGTTCAACATCGTCTTCACCTCCCTCTTCTCTCTGGAATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 253154 GCCCTGCGGGTGTTCAACATCGTCTTCACCTCCCTCTTCTCTCTGGAATG

   5100     .    :    .    :    .    :    .    :    .    :
   4874 TGTGCTGAAAGTCATGGCTTTTGGGATTCTG         AATTATTTCC
        |||||||||||||||||||||||||||||||>>>...>>>||||||||||
 253204 TGTGCTGAAAGTCATGGCTTTTGGGATTCTGGTA...TAGAATTATTTCC

   5150     .    :    .    :    .    :    .    :    .    :
   4915 GCGATGCCTGGAACATCTTCGACTTTGTGACTGTTCTGGGCAGCATCACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 260970 GCGATGCCTGGAACATCTTCGACTTTGTGACTGTTCTGGGCAGCATCACC

   5200     .    :    .    :    .    :    .    :    .    :
   4965 GATATCCTCGTGACTGAGTTTGGG         AATAACTTCATCAACCT
        ||||||||||||||||||||||||>>>...>>>|||||||||||||||||
 261020 GATATCCTCGTGACTGAGTTTGGGGTA...CAGAATAACTTCATCAACCT

   5250     .    :    .    :    .    :    .    :    .    :
   5006 GAGCTTTCTCCGCCTCTTCCGAGCTGCCCGGCTCATCAAACTTCTCCGTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 270512 GAGCTTTCTCCGCCTCTTCCGAGCTGCCCGGCTCATCAAACTTCTCCGTC

   5300     .    :    .    :    .    :    .    :    .    :
   5056 AGGGTTACACCATCCGCATTCTTCTCTGGACCTTTGTGCAGTCCTTCAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 270562 AGGGTTACACCATCCGCATTCTTCTCTGGACCTTTGTGCAGTCCTTCAAG

   5350     .    :    .    :    .    :    .    :    .    :
   5106          GCCCTGCCTTATGTCTGTCTGCTGATCGCCATGCTCTTCTT
        >>>...>>>|||||||||||||||||||||||||||||||||||||||||
 270612 GTG...CAGGCCCTGCCTTATGTCTGTCTGCTGATCGCCATGCTCTTCTT

   5400     .    :    .    :    .    :    .    :    .    :
   5147 CATCTATGCCATCATTGGGATGCAG         GTGTTTGGTAACATTG
        |||||||||||||||||||||||||>>>...>>>||||||||||||||||
 270992 CATCTATGCCATCATTGGGATGCAGGTG...CAGGTGTTTGGTAACATTG

   5450     .    :    .    :    .    :    .    :    .    :
   5188 GCATCGACGTGGAGGACGAGGACAGTGATGAAGATGAGTTCCAAATCACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 271205 GCATCGACGTGGAGGACGAGGACAGTGATGAAGATGAGTTCCAAATCACT

   5500     .    :    .    :    .    :    .    :    .    :
   5238 GAGCACAATAACTTCCGGACCTTCTTCCAGGCCCTCATGCTTCTCTTCCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 271255 GAGCACAATAACTTCCGGACCTTCTTCCAGGCCCTCATGCTTCTCTTCCG

   5550     .    :    .    :    .    :    .    :    .    :
   5288          GAGTGCTACCGGGGAAGCTTGGCACAACATCATGCTTTCCT
        >>>...>>>|||||| ||||||||||||||||||||||||||||||||||
 271305 GTG...CAGGAGTGCCACCGGGGAAGCTTGGCACAACATCATGCTTTCCT

   5600     .    :    .    :    .    :    .    :    .    :
   5329 GCCTCAGCGGGAAACCGTGTGATAAGAACTCTGGCATCCTGACTCGAGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 274406 GCCTCAGCGGGAAACCGTGTGATAAGAACTCTGGCATCCTGACTCGAGAG

   5650     .    :    .    :    .    :    .    :    .    :
   5379 TGTGGCAATGAATTTGCTTATTTTTACTTTGTTTCCTTCATCTTCCTCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 274456 TGTGGCAATGAATTTGCTTATTTTTACTTTGTTTCCTTCATCTTCCTCTG

   5700     .    :    .    :    .    :    .    :    .    :
   5429 CTCGTTTCTG         ATGCTGAATCTCTTTGTCGCCGTCATCATGG
        ||||||||||>>>...>>>|||||||||||||||||||||||||||||||
 274506 CTCGTTTCTGGTG...CAGATGCTGAATCTCTTTGTCGCCGTCATCATGG

   5750     .    :    .    :    .    :    .    :    .    :
   5470 ACAACTTTGAGTACCTCACCCGAGACTCCTCCATCCTGGGCCCCCACCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 276047 ACAACTTTGAGTACCTCACCCGAGACTCCTCCATCCTGGGCCCCCACCAC

   5800     .    :    .    :    .    :    .    :    .    :
   5520 CTGGATGAGTACGTGCGTGTCTGGGCCGAGTATGACCCCGCAGCTTG   
        |||||||||||||||||||||||||||||||||||||||||||||||>>>
 276097 CTGGATGAGTACGTGCGTGTCTGGGCCGAGTATGACCCCGCAGCTTGGTA

   5850     .    :    .    :    .    :    .    :    .    :
   5567       CGGTCGGATTCATTATAAGGATATGTACAGTTTATTACGAGTAA
        ...>>>||||||||||||||||||||||||||||||||||||||||||||
 276147 ...CAGCGGTCGGATTCATTATAAGGATATGTACAGTTTATTACGAGTAA

   5900     .    :    .    :    .    :    .    :    .    :
   5611 TGTCTCCGCCCCTCGGCTTAGGGAAGAAGTGTCCGC CAGGAGTGGCTTA
        | ||||| || ||||||||||| ||||| ||||| |- |||-|| |||| 
 277474 TATCTCCCCCTCTCGGCTTAGGCAAGAAATGTCCTCATAGG GTTGCTTG

   5950     .    :    .    :    .    :    .    :    .    :
   5660 CAAG         CGGCTTCTGCGGATGGACCTGCCCGTCGCAGATGACA
        ||||>>>...>>>|||||||||||||||||||||||||||||||||||||
 277523 CAAGGTT...TAGCGGCTTCTGCGGATGGACCTGCCCGTCGCAGATGACA

   6000     .    :    .    :    .    :    .    :    .    :
   5701 ACACCGTCCACTTCAATTCCACCCTCATGGCTCTGATCCGCACAGCCCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 281490 ACACCGTCCACTTCAATTCCACCCTCATGGCTCTGATCCGCACAGCCCTG

   6050     .    :    .    :    .    :    .    :    .    :
   5751 GACATCAAGATTGCCAAGG         GAGGAGCCGACAAACAGCAGAT
        |||||||||||||||||||>>>...>>>||||||||||||||||||||||
 281540 GACATCAAGATTGCCAAGGGTA...CAGGAGGAGCCGACAAACAGCAGAT

   6100     .    :    .    :    .    :    .    :    .    :
   5792 GGACGCTGAGCTGCGGAAGGAGATGATGGCGATTTGGCCCAATCTGTCCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 291639 GGACGCTGAGCTGCGGAAGGAGATGATGGCGATTTGGCCCAATCTGTCCC

   6150     .    :    .    :    .    :    .    :    .    :
   5842 AGAAGACGCTAGACCTGCTGGTCACACCTCACAAGT         CCACG
        ||||||||||||||||||||||||||||||||||||>>>...>>>|||||
 291689 AGAAGACGCTAGACCTGCTGGTCACACCTCACAAGTGTA...CAGCCACG

   6200     .    :    .    :    .    :    .    :    .    :
   5883 GACCTCACCGTGGGGAAGATCTACGCAGCCATGATGATCATGGAGTACTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 291897 GACCTCACCGTGGGGAAGATCTACGCAGCCATGATGATCATGGAGTACTA

   6250     .    :    .    :    .    :    .    :    .    :
   5933 CCGGCAGAGCAAGGCCAAGAAGCTGCAGGCCATGCGCGAGGAGCAG    
        ||||||||||||||||||||||||||||||||||||||||||||||>>>.
 291947 CCGGCAGAGCAAGGCCAAGAAGCTGCAGGCCATGCGCGAGGAGCAGGTG.

   6300     .    :    .    :    .    :    .    :    .    :
   5979      GACCGGACACCCCTCATGTTCCAGCGCATGGAGCCCCCGTCCCCA
        ..>>>|||||||||||||||||||||||||||||||||||||||||||||
 291997 ..CAGGACCGGACACCCCTCATGTTCCAGCGCATGGAGCCCCCGTCCCCA

   6350     .    :    .    :    .    :    .    :    .    :
   6024 ACGCAGGAAGGGGGACCTGGCCAGAACGCCCTCCCCTCCACCCAGCTGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 293530 ACGCAGGAAGGGGGACCTGGCCAGAACGCCCTCCCCTCCACCCAGCTGGA

   6400     .    :    .    :    .    :    .    :    .    :
   6074 CCCAGGAGGAGCCCT         GATGGCTCACGAAAGCGGCCTCAAGG
        |||||||||||||||>>>...>>>||||||||||||||||||||||||||
 293580 CCCAGGAGGAGCCCTGTG...CAGGATGGCTCACGAAAGCGGCCTCAAGG

   6450     .    :    .    :    .    :    .    :    .    :
   6115 AGAGCCCGTCCTGGGTGACCCAGCGTGCCCAGGAGATGTTCCAGAAGACG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 293729 AGAGCCCGTCCTGGGTGACCCAGCGTGCCCAGGAGATGTTCCAGAAGACG

   6500     .    :    .    :    .    :    .    :    .    :
   6165 GGCACATGGAGTCCGGAACAAGGCCCCCCTACCGACATGCCCAACAGCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 293779 GGCACATGGAGTCCGGAACAAGGCCCCCCTACCGACATGCCCAACAGCCA

   6550     .    :    .    :    .    :    .    :    .    :
   6215 GCCTAACTCTCAG         TCCGTGGAGATGCGAGAGATGGGCAGAG
        |||||||||||||>>>...>>>||||||||||||||||||||||||||||
 293829 GCCTAACTCTCAGGTG...CAGTCCGTGGAGATGCGAGAGATGGGCAGAG

   6600     .    :    .    :    .    :    .    :    .    :
   6256 ATGGCTACTCCGACAGCGAGCACTACCTCCCCATGGAAGGCCAGGGCCGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 294037 ATGGCTACTCCGACAGCGAGCACTACCTCCCCATGGAAGGCCAGGGCCGG

   6650     .    :    .    :    .    :    .    :    .    :
   6306 GCTGCCTCCATGCCCCGCCTCCCTGCAGAGAACCAG         AGGAG
        ||||||||||||||||||||||||||||||||||||>>>...>>>|||||
 294087 GCTGCCTCCATGCCCCGCCTCCCTGCAGAGAACCAGGTG...CAGAGGAG

   6700     .    :    .    :    .    :    .    :    .    :
   6347 AAGGGGCCGGCCACGTGGGAATAACCTCAGT         ACCATCTCAG
        |||||||||||||||||||||||||||||||>>>...>>>||||||||||
 295578 AAGGGGCCGGCCACGTGGGAATAACCTCAGTGTA...CAGACCATCTCAG

   6750     .    :    .    :    .    :    .    :    .    :
   6388 ACACCAGCCCCATGAAGCGTTCAGCCTCCGTGCTGGGCCCCAAGGCCCGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 296737 ACACCAGCCCCATGAAGCGTTCAGCCTCCGTGCTGGGCCCCAAGGCCCGA

   6800     .    :    .    :    .    :    .    :    .    :
   6438 CGCCTGGACGATTACTCGCTGGAGCGGGTCCCGCCCGAGGAGAACCAGCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 296787 CGCCTGGACGATTACTCGCTGGAGCGGGTCCCGCCCGAGGAGAACCAGCG

   6850     .    :    .    :    .    :    .    :    .    :
   6488 GCACCACCAGCGGCGCCGCGACCGCAGCCACCGCGCCTCTGAGCGCTCCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 296837 GCACCACCAGCGGCGCCGCGACCGCAGCCACCGCGCCTCTGAGCGCTCCC

   6900     .    :    .    :    .    :    .    :    .    :
   6538 TGGGCCGCTACACCGATGTGGACACAG         GCTTGGGGACAGAC
        |||||||||||||||||||||||||||>>>...>>>||||||||||||||
 296887 TGGGCCGCTACACCGATGTGGACACAGGTG...CAGGCTTGGGGACAGAC

   6950     .    :    .    :    .    :    .    :    .    :
   6579 CTGAGCATGACCACCCAATCCGGGGACCTGCCGTCGAAGGAGCGGGACCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 297230 CTGAGCATGACCACCCAATCCGGGGACCTGCCGTCGAAGGAGCGGGACCA

   7000     .    :    .    :    .    :    .    :    .    :
   6629 GGAGCGGGGCCGGCCCAAGGATCGGAAGCATCGACAGCACCACCACCACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 297280 GGAGCGGGGCCGGCCCAAGGATCGGAAGCATCGACAGCACCACCACCACC

   7050     .    :    .    :    .    :    .    :    .    :
   6679 ACCACCACCACCACCATCCCCCGCCCCCCGACAAGGACCGCTATGCCCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 297330 ACCACCACCACCACCATCCCCCGCCCCCCGACAAGGACCGCTATGCCCAG

   7100     .    :    .    :    .    :    .    :    .    :
   6729 GAACGGCCGGACCACGGCCGGGCACGGGCTCGGGACCAGCGCTGGTCCCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 297380 GAACGGCCGGACCACGGCCGGGCACGGGCTCGGGACCAGCGCTGGTCCCG

   7150     .    :    .    :    .    :    .    :    .    :
   6779 CTCGCCCAGCGAGGGCCGAGAGCACATGGCGCACCGGCAG         G
        ||||||||||||||||||||||||||||||||||||||||>>>...>>>|
 297430 CTCGCCCAGCGAGGGCCGAGAGCACATGGCGCACCGGCAGGTG...TAGG

   7200     .    :    .    :    .    :    .    :    .    :
   6820 GCAGTAGTTCCGTAAGTGGAAGCCCAGCCCCCTCAACATCTGGTACCAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298173 GCAGTAGTTCCGTAAGTGGAAGCCCAGCCCCCTCAACATCTGGTACCAGC

   7250     .    :    .    :    .    :    .    :    .    :
   6870 ACTTCTCGGCGGGGCCGCCGCCAGCTCCCCCAGACCCCCTCCACCCCCCG
        ||| | ||||||||||||||||||||||||||||||||||||||||||||
 298223 ACTCCGCGGCGGGGCCGCCGCCAGCTCCCCCAGACCCCCTCCACCCCCCG

   7300     .    :    .    :    .    :    .    :    .    :
   6920 GCCACACGTGTCCTATTCCCCTGTGATCCGTAAGGCCGGCGGCTCGGGGC
        ||||||||||||||||||||||||||||||||||||||||||||------
 298273 GCCACACGTGTCCTATTCCCCTGTGATCCGTAAGGCCGGCGGCT      

   7350     .    :    .    :    .    :    .    :    .    :
   6970 CCCCGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
        -----------|-|--|--|--||--|--|--|--|-|||||||||||||
 298317            C G  G  G  GC  C  C  C  C GCAGCAGCAGCAG

   7400     .    :    .    :    .    :    .    :    .    :
   7020 CAGCAGCAGCAGCAGCAGCAGCAGCAGGCGGTGGCCAGGCCGGGCCGGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298340 CAGCAGCAGCAGCAGCAGCAGCAGCAGGCGGTGGCCAGGCCGGGCCGGGC

   7450     .    :    .    :    .    :    .    :    .    :
   7070 GGCCACCAGCGGCCCTCGGAGGTACCCAGGCCCCACGGCCGAGCCTCTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298390 GGCCACCAGCGGCCCTCGGAGGTACCCAGGCCCCACGGCCGAGCCTCTGG

   7500     .    :    .    :    .    :    .    :    .    :
   7120 CCGGAGATCGGCCGCCCACGGGGGGCCACAGCAGCGGCCGCTCGCCCAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298440 CCGGAGATCGGCCGCCCACGGGGGGCCACAGCAGCGGCCGCTCGCCCAGG

   7550     .    :    .    :    .    :    .    :    .    :
   7170 ATGGAGAGGCGGGTCCCAGGCCCGGCCCGGAGCGAGTCCCCCAGGGCCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298490 ATGGAGAGGCGGGTCCCAGGCCCGGCCCGGAGCGAGTCCCCCAGGGCCTG

   7600     .    :    .    :    .    :    .    :    .    :
   7220 TCGACACGGCGGGGCCCGGTGGCCGGCATCTGGCCCGCACGTGTCCGAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298540 TCGACACGGCGGGGCCCGGTGGCCGGCATCTGGCCCGCACGTGTCCGAGG

   7650     .    :    .    :    .    :    .    :    .    :
   7270 GGCCCCCGGGTCCCCGGCACCATGGCTACTACCGGGGCTCCGACTACGAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298590 GGCCCCCGGGTCCCCGGCACCATGGCTACTACCGGGGCTCCGACTACGAC

   7700     .    :    .    :    .    :    .    :    .    :
   7320 GAGGCCGATGGCCCGGGCAGCGGGGGCGGCGAGGAGGCCATGGCCGGGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298640 GAGGCCGATGGCCCGGGCAGCGGGGGCGGCGAGGAGGCCATGGCCGGGGC

   7750     .    :    .    :    .    :    .    :    .    :
   7370 CTACGACGCGCCACCCCCCGTACGACACGCGTCCTCGGGCGCCACCGGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 298690 CTACGACGCGCCACCCCCCGTACGACACGCGTCCTCGGGCGCCACCGGGC

   7800     .    :    .    :    .    :
   7420 GCTCGCCCAGGACTCCCCGGGCCTCGGGCCC
        |||||||||||||||||||||||||||||||
 298740 GCTCGCCCAGGACTCCCCGGGCCTCGGGCCC

END