Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AA917008.1
Subject Sequence ID: ENSG00000012048
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AA917008.1, 329 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000012048 (ENSG00000012048), 81091 bp

>gi|3056400|gb|AA917008.1|AA917008 on26e10.s1 NCI_CGAP_Lu5 Homo sapiens cDNA clone IMAGE:1557834 3' similar to contains Alu repetitive element;, mRNA sequence
>ENSG00000012048

(complement)

1-329  (80536-80864)   98%

      0     .    :    .    :    .    :    .    :    .    :
      1 AGACAGAGCCTGGGTGACAGTGAGACTGTGGCTC AAAAAAAAAAAAAAT
        |  | -||||||||||||||||||||||||||||-|||||||||||||| 
  80536 ACTCC AGCCTGGGTGACAGTGAGACTGTGGCTCAAAAAAAAAAAAAAAA

     50     .    :    .    :    .    :    .    :    .    :
     50 AAAGGAAAATGAAACTAGAAGAGATTTCTAAAAGTCTGAGATATATTTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80585 AAAGGAAAATGAAACTAGAAGAGATTTCTAAAAGTCTGAGATATATTTGC

    100     .    :    .    :    .    :    .    :    .    :
    100 TAGATTTCTAAAGAATGTGTTCTAAAACAGCAGAAGATTTTCAAGAACCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80635 TAGATTTCTAAAGAATGTGTTCTAAAACAGCAGAAGATTTTCAAGAACCG

    150     .    :    .    :    .    :    .    :    .    :
    150 GTTTCCAAAGACAGTCTTCTAATTCCTCATTAGTAATAAGTAAAATGTTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80685 GTTTCCAAAGACAGTCTTCTAATTCCTCATTAGTAATAAGTAAAATGTTT

    200     .    :    .    :    .    :    .    :    .    :
    200 ATTGTTGTAGCTCTGGTATATAATCCATTCCTCTTAAAATATAAGACCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80735 ATTGTTGTAGCTCTGGTATATAATCCATTCCTCTTAAAATATAAGACCTC

    250     .    :    .    :    .    :    .    :    .    :
    250 TGGCATGAATATTTCATATCTATAAAATGACAGATCCCACCAGGAAGGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80785 TGGCATGAATATTTCATATCTATAAAATGACAGATCCCACCAGGAAGGAA

    300     .    :    .    :    .    :
    300 GCTGTTGCTTTCTTTGAGGTGATTTTTTTC
        ||||||||||||||||||||||||||||||
  80835 GCTGTTGCTTTCTTTGAGGTGATTTTTTTC

END