Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AA865794.1
Subject Sequence ID: ENSG00000012048
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AA865794.1, 270 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000012048 (ENSG00000012048), 81091 bp

>gi|2958070|gb|AA865794.1|AA865794 og96h04.s1 NCI_CGAP_Kid3 Homo sapiens cDNA clone IMAGE:1456183 3', mRNA sequence
>ENSG00000012048

8-270  (1-263)   100%

      0     .    :    .    :    .    :    .    :    .    :
      8 TGTTTGCTACCAAGTTTATTTGCAGTGTTAACAGCACAACATTTACAAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      1 TGTTTGCTACCAAGTTTATTTGCAGTGTTAACAGCACAACATTTACAAAA

     50     .    :    .    :    .    :    .    :    .    :
     58 CGTATTTTGTACAATCAAGTCTTCACTGCCCTTGCACACTGGGGGGGCTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     51 CGTATTTTGTACAATCAAGTCTTCACTGCCCTTGCACACTGGGGGGGCTA

    100     .    :    .    :    .    :    .    :    .    :
    108 GGGAAGACCTAGTCCTTCCAACAGCTATAAACAGTCCTGGATAATGGGTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    101 GGGAAGACCTAGTCCTTCCAACAGCTATAAACAGTCCTGGATAATGGGTT

    150     .    :    .    :    .    :    .    :    .    :
    158 TATGAAAAACACTTTTTCTTCCTTCAGCAAGCAAAATTATTTATGAAGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    151 TATGAAAAACACTTTTTCTTCCTTCAGCAAGCAAAATTATTTATGAAGCT

    200     .    :    .    :    .    :    .    :    .    :
    208 GTATGGTTTCAGCAACAGGGAGCAAAGGAAAAAAATCACCTCAAAGAAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    201 GTATGGTTTCAGCAACAGGGAGCAAAGGAAAAAAATCACCTCAAAGAAAG

    250     .    :
    258 CAACAGCTTCCTT
        |||||||||||||
    251 CAACAGCTTCCTT

END