Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AA773331.1
Subject Sequence ID: ENSG00000012048
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AA773331.1, 471 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000012048 (ENSG00000012048), 81091 bp

>gi|2824902|gb|AA773331.1|AA773331 ab65e10.s1 Stratagene lung carcinoma 937218 Homo sapiens cDNA clone IMAGE:845706 3', mRNA sequence
>ENSG00000012048

17-471  (1-455)   99%

      0     .    :    .    :    .    :    .    :    .    :
     17 TGTTTGCTATCATGTTTATTTGCAGTGTTAACAGCACAACATTTACAATA
        ||||||||| || ||||||||||||||||||||||||||||||||||| |
      1 TGTTTGCTACCAAGTTTATTTGCAGTGTTAACAGCACAACATTTACAAAA

     50     .    :    .    :    .    :    .    :    .    :
     67 CGTATTTTGTACAATCAAGTCTTCACTGCCCTTGCACACTGGGGGGGCTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     51 CGTATTTTGTACAATCAAGTCTTCACTGCCCTTGCACACTGGGGGGGCTA

    100     .    :    .    :    .    :    .    :    .    :
    117 GGGAAGACCTAGTCCTTCCAACAGCTATAAACAGTCCTGGATAATGGGTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    101 GGGAAGACCTAGTCCTTCCAACAGCTATAAACAGTCCTGGATAATGGGTT

    150     .    :    .    :    .    :    .    :    .    :
    167 TATGAAAAACACTTTTTCTTCCTTCAGCAAGCAAAATTATTTATGAAGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    151 TATGAAAAACACTTTTTCTTCCTTCAGCAAGCAAAATTATTTATGAAGCT

    200     .    :    .    :    .    :    .    :    .    :
    217 GTATGGTTTCAGCAACAGGGAGCAAAGGAAAAAAATCACCTCAAAGAAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    201 GTATGGTTTCAGCAACAGGGAGCAAAGGAAAAAAATCACCTCAAAGAAAG

    250     .    :    .    :    .    :    .    :    .    :
    267 CAACAGCTTCCTTCCTGGTGGGATCTGTCATTTTATAGATATGAAATATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    251 CAACAGCTTCCTTCCTGGTGGGATCTGTCATTTTATAGATATGAAATATT

    300     .    :    .    :    .    :    .    :    .    :
    317 CATGCCAGAGGTCTTATATTTTAAGAGGAATGGATTATATACCAGAGCTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    301 CATGCCAGAGGTCTTATATTTTAAGAGGAATGGATTATATACCAGAGCTA

    350     .    :    .    :    .    :    .    :    .    :
    367 CAACAATAAACATTTTACTTATTACTAATGAGGAATTAGAAGACTGTCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    351 CAACAATAAACATTTTACTTATTACTAATGAGGAATTAGAAGACTGTCTT

    400     .    :    .    :    .    :    .    :    .    :
    417 TGGAAACCGGTTCTTGAAAATCTTCTGCTGTTTTAGAACACATTCTTTAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    401 TGGAAACCGGTTCTTGAAAATCTTCTGCTGTTTTAGAACACATTCTTTAG

    450     .
    467 AAATC
        |||||
    451 AAATC

END